EMAIL THIS PAGE TO A FRIEND

MROH6

maestro heat-like repeat family member 6

24 Gene Product Result for
Synonyms: C8orf73
UniProtKB ID: A6NGR9, A8MWB1
Gene ID:
Mouse(223645) maestro heat-like repeat family member 6
Rat(100359562) maestro heat-like repeat family member 6
naked mole-rat(101722939) maestro heat-like repeat family member 6
domestic guinea pig(100729976) maestro heat-like repeat family member 6
cow(789886) maestro heat-like repeat family member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA068049 Anti-MROH6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100878 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100878 Rosetta Predictions human pricing
XM_925979 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322457 predicted 670
2 SASI_Hs02_00322458 predicted 1169
3 SASI_Hs02_00322459 predicted 671
4 SASI_Hs02_00322460 predicted 343
5 SASI_Hs02_00322461 predicted 1169
6 SASI_Hs02_00322462 predicted 822
7 SASI_Hs02_00322463 predicted 959
8 SASI_Hs02_00322464 predicted 1324
9 SASI_Hs02_00322465 predicted 895
10 SASI_Hs02_00322466 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285238 predicted 889
2 SASI_Hs01_00285239 predicted 1385
3 SASI_Hs01_00285240 predicted 878
4 SASI_Hs01_00285241 predicted 557
5 SASI_Hs01_00285242 predicted 303
6 SASI_Hs01_00285243 predicted 1376
7 SASI_Hs01_00285244 predicted 1038
8 SASI_Hs01_00285245 predicted 1174
9 SASI_Hs01_00285246 predicted 2109
10 SASI_Hs01_00285247 predicted 1539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100878
MROH6 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-675s21c1
Sequence:CCGGAGCCGTAACCAGCGTGTAAATCTCGAGATTTACACGCTGGTTACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100878.1-3031s21c1
Sequence:CCGGCTAGGATGCCTGCCTGGAAATCTCGAGATTTCCAGGCAGGCATCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-1177s21c1
Sequence:CCGGTCACGGCTATGGCCTTCTTCACTCGAGTGAAGAAGGCCATAGCCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-178s21c1
Sequence:CCGGCCAAGTCCTGGGAGGTCAAACCTCGAGGTTTGACCTCCCAGGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-896s21c1
Sequence:CCGGCATGCCCAAGATTTGGGTTCTCTCGAGAGAACCCAAATCTTGGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100878
MROH6 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-675s21c1
Sequence:CCGGAGCCGTAACCAGCGTGTAAATCTCGAGATTTACACGCTGGTTACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100878.1-3031s21c1
Sequence:CCGGCTAGGATGCCTGCCTGGAAATCTCGAGATTTCCAGGCAGGCATCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-1177s21c1
Sequence:CCGGTCACGGCTATGGCCTTCTTCACTCGAGTGAAGAAGGCCATAGCCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-178s21c1
Sequence:CCGGCCAAGTCCTGGGAGGTCAAACCTCGAGGTTTGACCTCCCAGGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-896s21c1
Sequence:CCGGCATGCCCAAGATTTGGGTTCTCTCGAGAGAACCCAAATCTTGGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100878
MROH6 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-675s21c1
Sequence:CCGGAGCCGTAACCAGCGTGTAAATCTCGAGATTTACACGCTGGTTACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100878.1-3031s21c1
Sequence:CCGGCTAGGATGCCTGCCTGGAAATCTCGAGATTTCCAGGCAGGCATCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-1177s21c1
Sequence:CCGGTCACGGCTATGGCCTTCTTCACTCGAGTGAAGAAGGCCATAGCCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-178s21c1
Sequence:CCGGCCAAGTCCTGGGAGGTCAAACCTCGAGGTTTGACCTCCCAGGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100878.1-896s21c1
Sequence:CCGGCATGCCCAAGATTTGGGTTCTCTCGAGAGAACCCAAATCTTGGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)