EMAIL THIS PAGE TO A FRIEND

MROH7

maestro heat-like repeat family member 7

244 Gene Product Result for
Synonyms: C1orf175 HEATR8
Gene ID:
Mouse(381538) maestro heat-like repeat family member 7
Rat(298301) maestro heat-like repeat family member 7
domestic guinea pig(100733195) maestro heat-like repeat family member 7
naked mole-rat(101697828) maestro heat-like repeat family member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001126487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001126487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001126487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198547 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039464 Rosetta Predictions human pricing
NM_001100965 Rosetta Predictions rat pricing
NM_001126487 Rosetta Predictions mouse pricing
XM_978122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308511 predicted 587
2 SASI_Hs01_00036008 predicted 3995
3 SASI_Hs02_00308512 predicted 817
4 SASI_Hs01_00036010 predicted 387
5 SASI_Hs01_00036011 predicted 3602
6 SASI_Hs01_00036012 predicted 1431
7 SASI_Hs01_00036013 predicted 3739
8 SASI_Hs02_00308513 predicted 2269
9 SASI_Hs02_00308514 predicted 680
10 SASI_Hs02_00308515 predicted 2528
11 SASI_Hs01_00036006 predicted 994
12 SASI_Hs01_00036007 predicted 1036
13 SASI_Hs01_00036009 predicted 995
14 SASI_Hs01_00036014 predicted 1294
15 SASI_Hs01_00036015 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210792 predicted 663
2 SASI_Rn02_00210793 predicted 613
3 SASI_Rn02_00210794 predicted 1730
4 SASI_Rn02_00210795 predicted 790
5 SASI_Rn02_00210796 predicted 3291
6 SASI_Rn02_00210797 predicted 1023
7 SASI_Rn02_00210798 predicted 1216
8 SASI_Rn02_00210799 predicted 3427
9 SASI_Rn02_00210800 predicted 2220
10 SASI_Rn02_00210801 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310061 predicted 1391
2 SASI_Mm02_00310062 predicted 330
3 SASI_Mm02_00310063 predicted 3843
4 SASI_Mm02_00310064 predicted 1198
5 SASI_Mm02_00310065 predicted 1730
6 SASI_Mm02_00310066 predicted 2104
7 SASI_Mm02_00310067 predicted 3885
8 SASI_Mm02_00310068 predicted 3575
9 SASI_Mm02_00310069 predicted 942
10 SASI_Mm02_00310070 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244389 predicted 851
2 SASI_Mm01_00244390 predicted 1132
3 SASI_Mm01_00244391 predicted 923
4 SASI_Mm01_00244392 predicted 1510
5 SASI_Mm01_00244393 predicted 1878
6 SASI_Mm01_00244394 predicted 664
7 SASI_Mm01_00244395 predicted 270
8 SASI_Mm01_00244396 predicted 1134
9 SASI_Mm01_00244397 predicted 678
10 SASI_Mm01_00244398 predicted 2586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126487
MROH7 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126487.1-4152s21c1
Sequence:CCGGACGCTATGTGGTCAACCTTTCCTCGAGGAAAGGTTGACCACATAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-751s21c1
Sequence:CCGGTTGGGTCAGAGTAACTCTAATCTCGAGATTAGAGTTACTCTGACCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-780s21c1
Sequence:CCGGGCCTGAGCCAAACCTATATATCTCGAGATATATAGGTTTGGCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-1274s21c1
Sequence:CCGGTGAGCAGCCATCGAGATTATTCTCGAGAATAATCTCGATGGCTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-2185s21c1
Sequence:CCGGCTGCGTGTCATTGCGGAATTTCTCGAGAAATTCCGCAATGACACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126487
MROH7 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126487.1-4152s21c1
Sequence:CCGGACGCTATGTGGTCAACCTTTCCTCGAGGAAAGGTTGACCACATAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-751s21c1
Sequence:CCGGTTGGGTCAGAGTAACTCTAATCTCGAGATTAGAGTTACTCTGACCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-780s21c1
Sequence:CCGGGCCTGAGCCAAACCTATATATCTCGAGATATATAGGTTTGGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-1274s21c1
Sequence:CCGGTGAGCAGCCATCGAGATTATTCTCGAGAATAATCTCGATGGCTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-2185s21c1
Sequence:CCGGCTGCGTGTCATTGCGGAATTTCTCGAGAAATTCCGCAATGACACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126487
MROH7 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126487.1-4152s21c1
Sequence:CCGGACGCTATGTGGTCAACCTTTCCTCGAGGAAAGGTTGACCACATAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-751s21c1
Sequence:CCGGTTGGGTCAGAGTAACTCTAATCTCGAGATTAGAGTTACTCTGACCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-780s21c1
Sequence:CCGGGCCTGAGCCAAACCTATATATCTCGAGATATATAGGTTTGGCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-1274s21c1
Sequence:CCGGTGAGCAGCCATCGAGATTATTCTCGAGAATAATCTCGATGGCTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126487.1-2185s21c1
Sequence:CCGGCTGCGTGTCATTGCGGAATTTCTCGAGAAATTCCGCAATGACACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198547
MROH7 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-1269s1c1
Sequence:CCGGGCATGACTCTAATCCTGGGTTCTCGAGAACCCAGGATTAGAGTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198547.1-725s1c1
Sequence:CCGGCCTCAGTCAAATTCTGAAGATCTCGAGATCTTCAGAATTTGACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-2068s1c1
Sequence:CCGGCATGCTTCTAACTCTGCCTTTCTCGAGAAAGGCAGAGTTAGAAGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198547.1-3957s1c1
Sequence:CCGGGCTGTTCTTACTTCATGGCTTCTCGAGAAGCCATGAAGTAAGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-2057s1c1
Sequence:CCGGGTGTTGAACCACATGCTTCTACTCGAGTAGAAGCATGTGGTTCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198547.1-2335s1c1
Sequence:CCGGGATCGAGGAATTTGGAGACTTCTCGAGAAGTCTCCAAATTCCTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-2263s1c1
Sequence:CCGGGCTATATGAGAGCAACAAGCACTCGAGTGCTTGTTGCTCTCATATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-426s1c1
Sequence:CCGGCTATGTTGAATCTGCTCCCAACTCGAGTTGGGAGCAGATTCAACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198547.1-1527s1c1
Sequence:CCGGCCTTTGATGAAGTGACCTCATCTCGAGATGAGGTCACTTCATCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-724s1c1
Sequence:CCGGCCCTCAGTCAAATTCTGAAGACTCGAGTCTTCAGAATTTGACTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198547.1-3640s1c1
Sequence:CCGGCCTGAAGAACATGGATGGGATCTCGAGATCCCATCCATGTTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-943s1c1
Sequence:CCGGGCTCAACATGGGCTCAAGAAACTCGAGTTTCTTGAGCCCATGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198547
MROH7 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-1269s1c1
Sequence:CCGGGCATGACTCTAATCCTGGGTTCTCGAGAACCCAGGATTAGAGTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198547.1-725s1c1
Sequence:CCGGCCTCAGTCAAATTCTGAAGATCTCGAGATCTTCAGAATTTGACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-2068s1c1
Sequence:CCGGCATGCTTCTAACTCTGCCTTTCTCGAGAAAGGCAGAGTTAGAAGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198547.1-3957s1c1
Sequence:CCGGGCTGTTCTTACTTCATGGCTTCTCGAGAAGCCATGAAGTAAGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-2057s1c1
Sequence:CCGGGTGTTGAACCACATGCTTCTACTCGAGTAGAAGCATGTGGTTCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198547.1-2335s1c1
Sequence:CCGGGATCGAGGAATTTGGAGACTTCTCGAGAAGTCTCCAAATTCCTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-2263s1c1
Sequence:CCGGGCTATATGAGAGCAACAAGCACTCGAGTGCTTGTTGCTCTCATATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-426s1c1
Sequence:CCGGCTATGTTGAATCTGCTCCCAACTCGAGTTGGGAGCAGATTCAACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198547.1-1527s1c1
Sequence:CCGGCCTTTGATGAAGTGACCTCATCTCGAGATGAGGTCACTTCATCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-724s1c1
Sequence:CCGGCCCTCAGTCAAATTCTGAAGACTCGAGTCTTCAGAATTTGACTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198547.1-3640s1c1
Sequence:CCGGCCTGAAGAACATGGATGGGATCTCGAGATCCCATCCATGTTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-943s1c1
Sequence:CCGGGCTCAACATGGGCTCAAGAAACTCGAGTTTCTTGAGCCCATGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198547
MROH7 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-1269s1c1
Sequence:CCGGGCATGACTCTAATCCTGGGTTCTCGAGAACCCAGGATTAGAGTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198547.1-725s1c1
Sequence:CCGGCCTCAGTCAAATTCTGAAGATCTCGAGATCTTCAGAATTTGACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-2068s1c1
Sequence:CCGGCATGCTTCTAACTCTGCCTTTCTCGAGAAAGGCAGAGTTAGAAGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198547.1-3957s1c1
Sequence:CCGGGCTGTTCTTACTTCATGGCTTCTCGAGAAGCCATGAAGTAAGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-2057s1c1
Sequence:CCGGGTGTTGAACCACATGCTTCTACTCGAGTAGAAGCATGTGGTTCAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198547.1-2335s1c1
Sequence:CCGGGATCGAGGAATTTGGAGACTTCTCGAGAAGTCTCCAAATTCCTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-2263s1c1
Sequence:CCGGGCTATATGAGAGCAACAAGCACTCGAGTGCTTGTTGCTCTCATATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-426s1c1
Sequence:CCGGCTATGTTGAATCTGCTCCCAACTCGAGTTGGGAGCAGATTCAACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198547.1-1527s1c1
Sequence:CCGGCCTTTGATGAAGTGACCTCATCTCGAGATGAGGTCACTTCATCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-724s1c1
Sequence:CCGGCCCTCAGTCAAATTCTGAAGACTCGAGTCTTCAGAATTTGACTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198547.1-3640s1c1
Sequence:CCGGCCTGAAGAACATGGATGGGATCTCGAGATCCCATCCATGTTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198547.1-943s1c1
Sequence:CCGGGCTCAACATGGGCTCAAGAAACTCGAGTTTCTTGAGCCCATGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)