EMAIL THIS PAGE TO A FRIEND

MROH8

maestro heat-like repeat family member 8

92 Gene Product Result for
Synonyms: C20orf131 C20orf132 dJ621N11.3 dJ621N11.4
UniProtKB ID: Q9H579, Q5JYQ6
Gene ID:
Mouse(629499) maestro heat-like repeat family member 8
Rat(100360777) maestro heat-like repeat family member 8
cow(788470) maestro heat-like repeat family member 8
naked mole-rat(101699691) maestro heat-like repeat family member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU165241 MISSION® esiRNA esiRNA targeting mouse 4922505G16Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152503 Rosetta Predictions human pricing
NM_213631 Rosetta Predictions human pricing
NM_213632 Rosetta Predictions human pricing
NM_001039557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366281 predicted 757
2 SASI_Hs01_00025688 predicted 731
3 SASI_Hs02_00366282 predicted 797
4 SASI_Hs01_00025689 predicted 451
5 SASI_Hs02_00366283 predicted 802
6 SASI_Hs01_00025692 predicted 719
7 SASI_Hs02_00366284 predicted 552
8 SASI_Hs02_00366285 predicted 571
9 SASI_Hs02_00366286 predicted 664
10 SASI_Hs01_00025694 predicted 444
11 SASI_Hs01_00025687 predicted 704
12 SASI_Hs01_00025690 predicted 411
13 SASI_Hs01_00025691 predicted 208
14 SASI_Hs01_00025693 predicted 411
15 SASI_Hs01_00025695 predicted 707
16 SASI_Hs01_00025696 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374309 predicted 787
2 SASI_Hs01_00129687 predicted 754
3 SASI_Hs02_00374310 predicted 829
4 SASI_Hs01_00129688 predicted 479
5 SASI_Hs02_00374311 predicted 831
6 SASI_Hs01_00129691 predicted 748
7 SASI_Hs02_00374312 predicted 584
8 SASI_Hs02_00374313 predicted 603
9 SASI_Hs02_00374314 predicted 695
10 SASI_Hs01_00129693 predicted 480
11 SASI_Hs01_00129686 predicted 701
12 SASI_Hs01_00129689 predicted 410
13 SASI_Hs01_00129690 predicted 206
14 SASI_Hs01_00129692 predicted 412
15 SASI_Hs01_00129694 predicted 705
16 SASI_Hs01_00129695 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374315 predicted 792
2 SASI_Hs01_00022513 predicted 761
3 SASI_Hs02_00374316 predicted 826
4 SASI_Hs01_00022514 predicted 479
5 SASI_Hs02_00374317 predicted 828
6 SASI_Hs01_00022517 predicted 745
7 SASI_Hs02_00374318 predicted 586
8 SASI_Hs02_00374319 predicted 602
9 SASI_Hs02_00374320 predicted 694
10 SASI_Hs01_00022519 predicted 477
11 SASI_Hs01_00022512 predicted 703
12 SASI_Hs01_00022515 predicted 419
13 SASI_Hs01_00022516 predicted 207
14 SASI_Hs01_00022518 predicted 420
15 SASI_Hs01_00022520 predicted 706
16 SASI_Hs01_00022521 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133249 predicted 1460
2 SASI_Mm01_00133250 predicted 2231
3 SASI_Mm01_00133251 predicted 2927
4 SASI_Mm01_00133253 predicted 2861
5 SASI_Mm02_00290143 predicted 433
6 SASI_Mm01_00133254 predicted 526
7 SASI_Mm01_00133255 predicted 1416
8 SASI_Mm02_00290144 predicted 3054
9 SASI_Mm02_00290145 predicted 1074
10 SASI_Mm01_00133256 predicted 2726
11 SASI_Mm01_00133252 predicted 231
12 SASI_Mm01_00133257 predicted 406
13 SASI_Mm01_00133258 predicted 2378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152503
MROH8 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-894s1c1
Sequence:CCGGCTCTGAAGATCGAGCTGAGTTCTCGAGAACTCAGCTCGATCTTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-1116s1c1
Sequence:CCGGGCGATTCCAAAGACTTGGACACTCGAGTGTCCAAGTCTTTGGAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-1619s1c1
Sequence:CCGGCCAGACCCAAGTACACAGATACTCGAGTATCTGTGTACTTGGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-1551s1c1
Sequence:CCGGCCAGTTATCCATAATCAGCCACTCGAGTGGCTGATTATGGATAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-430s1c1
Sequence:CCGGGCCTATGACAGTGATTCAGAACTCGAGTTCTGAATCACTGTCATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152503.1-1786s1c1
Sequence:CCGGGCACAGGAGAAGATGGCATATCTCGAGATATGCCATCTTCTCCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152503
MROH8 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-894s1c1
Sequence:CCGGCTCTGAAGATCGAGCTGAGTTCTCGAGAACTCAGCTCGATCTTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-1116s1c1
Sequence:CCGGGCGATTCCAAAGACTTGGACACTCGAGTGTCCAAGTCTTTGGAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-1619s1c1
Sequence:CCGGCCAGACCCAAGTACACAGATACTCGAGTATCTGTGTACTTGGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-1551s1c1
Sequence:CCGGCCAGTTATCCATAATCAGCCACTCGAGTGGCTGATTATGGATAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-430s1c1
Sequence:CCGGGCCTATGACAGTGATTCAGAACTCGAGTTCTGAATCACTGTCATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152503.1-1786s1c1
Sequence:CCGGGCACAGGAGAAGATGGCATATCTCGAGATATGCCATCTTCTCCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152503
MROH8 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-894s1c1
Sequence:CCGGCTCTGAAGATCGAGCTGAGTTCTCGAGAACTCAGCTCGATCTTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-1116s1c1
Sequence:CCGGGCGATTCCAAAGACTTGGACACTCGAGTGTCCAAGTCTTTGGAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-1619s1c1
Sequence:CCGGCCAGACCCAAGTACACAGATACTCGAGTATCTGTGTACTTGGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-1551s1c1
Sequence:CCGGCCAGTTATCCATAATCAGCCACTCGAGTGGCTGATTATGGATAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152503.1-430s1c1
Sequence:CCGGGCCTATGACAGTGATTCAGAACTCGAGTTCTGAATCACTGTCATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152503.1-1786s1c1
Sequence:CCGGGCACAGGAGAAGATGGCATATCTCGAGATATGCCATCTTCTCCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039557
MROH8 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-1470s21c1
Sequence:CCGGCAGTTTATCATGACGATATTGCTCGAGCAATATCGTCATGATAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-2515s21c1
Sequence:CCGGAGACCGATGAGAGGATCATTTCTCGAGAAATGATCCTCTCATCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039557.3-3283s21c1
Sequence:CCGGGGAGAAGCTAAAGTAACAAACCTCGAGGTTTGTTACTTTAGCTTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-1643s21c1
Sequence:CCGGTGTCCGGCAACAGATCATAAACTCGAGTTTATGATCTGTTGCCGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-3005s21c1
Sequence:CCGGTGTAGGGCTCTTATCACATTACTCGAGTAATGTGATAAGAGCCCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039557
MROH8 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-1470s21c1
Sequence:CCGGCAGTTTATCATGACGATATTGCTCGAGCAATATCGTCATGATAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-2515s21c1
Sequence:CCGGAGACCGATGAGAGGATCATTTCTCGAGAAATGATCCTCTCATCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039557.3-3283s21c1
Sequence:CCGGGGAGAAGCTAAAGTAACAAACCTCGAGGTTTGTTACTTTAGCTTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-1643s21c1
Sequence:CCGGTGTCCGGCAACAGATCATAAACTCGAGTTTATGATCTGTTGCCGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-3005s21c1
Sequence:CCGGTGTAGGGCTCTTATCACATTACTCGAGTAATGTGATAAGAGCCCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039557
MROH8 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-1470s21c1
Sequence:CCGGCAGTTTATCATGACGATATTGCTCGAGCAATATCGTCATGATAAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-2515s21c1
Sequence:CCGGAGACCGATGAGAGGATCATTTCTCGAGAAATGATCCTCTCATCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039557.3-3283s21c1
Sequence:CCGGGGAGAAGCTAAAGTAACAAACCTCGAGGTTTGTTACTTTAGCTTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-1643s21c1
Sequence:CCGGTGTCCGGCAACAGATCATAAACTCGAGTTTATGATCTGTTGCCGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039557.3-3005s21c1
Sequence:CCGGTGTAGGGCTCTTATCACATTACTCGAGTAATGTGATAAGAGCCCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)