EMAIL THIS PAGE TO A FRIEND

MRP63

mitochondrial ribosomal protein 63

56 Gene Product Result for
Synonyms: bMRP63
UniProtKB ID: Q9BQC6, A2A332
Gene ID:
Human(78988) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a protein which belongs to an undetermined ribosomal subunit and which seems to be specific to animal mitoribosomes. Pseudogenes corresponding to this gene are found on chromosomes 1p, 1q, 3p, 5q, 8q, 14q, and Y. [provided by RefSeq, Jul 2008]
Mouse(67840) mitochondrial ribosomal protein 63
Rat(691814) mitochondrial ribosomal protein 63
Zebrafish(393748) mitochondrial ribosomal protein 63
domestic cat(101083821) mitochondrial ribosomal protein 63
cow(615666) mitochondrial ribosomal protein 63
dog(609387) mitochondrial ribosomal protein 63
chicken(771615) mitochondrial ribosomal protein 63
naked mole-rat(101703758) mitochondrial ribosomal protein 63
domestic guinea pig(100716018) mitochondrial ribosomal protein 63
sheep(101117428) mitochondrial ribosomal protein 63
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024026 Rosetta Predictions human pricing
NM_001109649 Rosetta Predictions rat pricing
NM_026401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109552 predicted 1009
2 SASI_Hs02_00356449 predicted 1030
3 SASI_Hs01_00109553 predicted 797
4 SASI_Hs01_00109554 predicted 739
5 SASI_Hs02_00356450 predicted 1022
6 SASI_Hs01_00109555 predicted 786
7 SASI_Hs01_00109556 predicted 919
8 SASI_Hs01_00109557 predicted 917
9 SASI_Hs02_00356451 predicted 890
10 SASI_Hs01_00109559 predicted 769
11 SASI_Hs01_00109558 predicted 892
12 SASI_Hs01_00109560 predicted 788
13 SASI_Hs01_00109561 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250422 predicted 329
2 SASI_Rn02_00250423 predicted 255
3 SASI_Rn02_00250424 predicted 304
4 SASI_Rn02_00250425 predicted 380
5 SASI_Rn02_00250426 predicted 293
6 SASI_Rn02_00250427 predicted 380
7 SASI_Rn02_00250428 predicted 388
8 SASI_Rn02_00250429 predicted 410
9 SASI_Rn02_00250430 predicted 335
10 SASI_Rn02_00250431 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069358 predicted 428
2 SASI_Mm01_00069359 predicted 370
3 SASI_Mm01_00069350 predicted 480
4 SASI_Mm01_00069351 predicted 397
5 SASI_Mm01_00069352 predicted 300
6 SASI_Mm01_00069353 predicted 634
7 SASI_Mm01_00069354 predicted 748
8 SASI_Mm01_00069356 predicted 511
9 SASI_Mm01_00069357 predicted 656
10 SASI_Mm01_00069355 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024026
VALIDATED
MRP63 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein 63
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024026.4-1031s1c1
Sequence:CCGGCCTCAGTCACAGATGATATTTCTCGAGAAATATCATCTGTGACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024026.4-2132s1c1
Sequence:CCGGCTTCTGTAATCCCATCACTTTCTCGAGAAAGTGATGGGATTACAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_024026.4-894s1c1
Sequence:CCGGCCTTTGGACCAGTCTTTATTACTCGAGTAATAAAGACTGGTCCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_024026.4-770s1c1
Sequence:CCGGCATCTCAATGTCACCAAGAAACTCGAGTTTCTTGGTGACATTGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024026.4-1073s1c1
Sequence:CCGGCCACAATGATTTGAGGTCTTTCTCGAGAAAGACCTCAAATCATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024026.4-769s1c1
Sequence:CCGGCCATCTCAATGTCACCAAGAACTCGAGTTCTTGGTGACATTGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024026.4-1072s1c1
Sequence:CCGGGCCACAATGATTTGAGGTCTTCTCGAGAAGACCTCAAATCATTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024026.4-622s1c1
Sequence:CCGGGAACCATTACTGGCTGAGCATCTCGAGATGCTCAGCCAGTAATGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024026.4-694s21c1
Sequence:CCGGGGAGGCCTTCGAGGCCATAAACTCGAGTTTATGGCCTCGAAGGCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024026.4-780s21c1
Sequence:CCGGTCACCAAGAAATGGTCCTAATCTCGAGATTAGGACCATTTCTTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024026.4-930s21c1
Sequence:CCGGAGTAGTCTGCATATCGAATATCTCGAGATATTCGATATGCAGACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024026.4-758s21c1
Sequence:CCGGGACCAGCTCGACCATCTCAATCTCGAGATTGAGATGGTCGAGCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_024026.4-610s21c1
Sequence:CCGGGATCGAGGCGGAGAACCATTACTCGAGTAATGGTTCTCCGCCTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024026
VALIDATED
MRP63 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein 63
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024026.4-1031s1c1
Sequence:CCGGCCTCAGTCACAGATGATATTTCTCGAGAAATATCATCTGTGACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024026.4-2132s1c1
Sequence:CCGGCTTCTGTAATCCCATCACTTTCTCGAGAAAGTGATGGGATTACAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_024026.4-894s1c1
Sequence:CCGGCCTTTGGACCAGTCTTTATTACTCGAGTAATAAAGACTGGTCCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_024026.4-770s1c1
Sequence:CCGGCATCTCAATGTCACCAAGAAACTCGAGTTTCTTGGTGACATTGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024026.4-1073s1c1
Sequence:CCGGCCACAATGATTTGAGGTCTTTCTCGAGAAAGACCTCAAATCATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024026.4-769s1c1
Sequence:CCGGCCATCTCAATGTCACCAAGAACTCGAGTTCTTGGTGACATTGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024026.4-1072s1c1
Sequence:CCGGGCCACAATGATTTGAGGTCTTCTCGAGAAGACCTCAAATCATTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024026.4-622s1c1
Sequence:CCGGGAACCATTACTGGCTGAGCATCTCGAGATGCTCAGCCAGTAATGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024026.4-694s21c1
Sequence:CCGGGGAGGCCTTCGAGGCCATAAACTCGAGTTTATGGCCTCGAAGGCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024026.4-780s21c1
Sequence:CCGGTCACCAAGAAATGGTCCTAATCTCGAGATTAGGACCATTTCTTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024026.4-930s21c1
Sequence:CCGGAGTAGTCTGCATATCGAATATCTCGAGATATTCGATATGCAGACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024026.4-758s21c1
Sequence:CCGGGACCAGCTCGACCATCTCAATCTCGAGATTGAGATGGTCGAGCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_024026.4-610s21c1
Sequence:CCGGGATCGAGGCGGAGAACCATTACTCGAGTAATGGTTCTCCGCCTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024026
VALIDATED
MRP63 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein 63
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024026.4-1031s1c1
Sequence:CCGGCCTCAGTCACAGATGATATTTCTCGAGAAATATCATCTGTGACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024026.4-2132s1c1
Sequence:CCGGCTTCTGTAATCCCATCACTTTCTCGAGAAAGTGATGGGATTACAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_024026.4-894s1c1
Sequence:CCGGCCTTTGGACCAGTCTTTATTACTCGAGTAATAAAGACTGGTCCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_024026.4-770s1c1
Sequence:CCGGCATCTCAATGTCACCAAGAAACTCGAGTTTCTTGGTGACATTGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024026.4-1073s1c1
Sequence:CCGGCCACAATGATTTGAGGTCTTTCTCGAGAAAGACCTCAAATCATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024026.4-769s1c1
Sequence:CCGGCCATCTCAATGTCACCAAGAACTCGAGTTCTTGGTGACATTGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024026.4-1072s1c1
Sequence:CCGGGCCACAATGATTTGAGGTCTTCTCGAGAAGACCTCAAATCATTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024026.4-622s1c1
Sequence:CCGGGAACCATTACTGGCTGAGCATCTCGAGATGCTCAGCCAGTAATGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024026.4-694s21c1
Sequence:CCGGGGAGGCCTTCGAGGCCATAAACTCGAGTTTATGGCCTCGAAGGCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024026.4-780s21c1
Sequence:CCGGTCACCAAGAAATGGTCCTAATCTCGAGATTAGGACCATTTCTTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024026.4-930s21c1
Sequence:CCGGAGTAGTCTGCATATCGAATATCTCGAGATATTCGATATGCAGACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024026.4-758s21c1
Sequence:CCGGGACCAGCTCGACCATCTCAATCTCGAGATTGAGATGGTCGAGCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_024026.4-610s21c1
Sequence:CCGGGATCGAGGCGGAGAACCATTACTCGAGTAATGGTTCTCCGCCTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026401
VALIDATED
MRP63 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein 63
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026401.1-1344s1c1
Sequence:CCGGCCTGAGATAGATGAGACCATTCTCGAGAATGGTCTCATCTATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-333s1c1
Sequence:CCGGCAAGTTCCCTAAGCATAGATACTCGAGTATCTATGCTTAGGGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-180s1c1
Sequence:CCGGCCAAGCGAAGGAGAGCATGATCTCGAGATCATGCTCTCCTTCGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-381s1c1
Sequence:CCGGCATCTCGAAGAAATGGTCCTACTCGAGTAGGACCATTTCTTCGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-345s1c1
Sequence:CCGGGCATAGATACATTGCAGACCACTCGAGTGGTCTGCAATGTATCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-179s21c1
Sequence:CCGGCCAAGCGAAGGAGAGCATGATCTCGAGATCATGCTCTCCTTCGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-332s21c1
Sequence:CCGGCAAGTTCCCTAAGCATAGATACTCGAGTATCTATGCTTAGGGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-380s21c1
Sequence:CCGGCATCTCGAAGAAATGGTCCTACTCGAGTAGGACCATTTCTTCGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-344s21c1
Sequence:CCGGGCATAGATACATTGCAGACCACTCGAGTGGTCTGCAATGTATCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026401
VALIDATED
MRP63 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein 63
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026401.1-1344s1c1
Sequence:CCGGCCTGAGATAGATGAGACCATTCTCGAGAATGGTCTCATCTATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-333s1c1
Sequence:CCGGCAAGTTCCCTAAGCATAGATACTCGAGTATCTATGCTTAGGGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-180s1c1
Sequence:CCGGCCAAGCGAAGGAGAGCATGATCTCGAGATCATGCTCTCCTTCGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-381s1c1
Sequence:CCGGCATCTCGAAGAAATGGTCCTACTCGAGTAGGACCATTTCTTCGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-345s1c1
Sequence:CCGGGCATAGATACATTGCAGACCACTCGAGTGGTCTGCAATGTATCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-179s21c1
Sequence:CCGGCCAAGCGAAGGAGAGCATGATCTCGAGATCATGCTCTCCTTCGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-332s21c1
Sequence:CCGGCAAGTTCCCTAAGCATAGATACTCGAGTATCTATGCTTAGGGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-380s21c1
Sequence:CCGGCATCTCGAAGAAATGGTCCTACTCGAGTAGGACCATTTCTTCGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-344s21c1
Sequence:CCGGGCATAGATACATTGCAGACCACTCGAGTGGTCTGCAATGTATCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026401
VALIDATED
MRP63 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein 63
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026401.1-1344s1c1
Sequence:CCGGCCTGAGATAGATGAGACCATTCTCGAGAATGGTCTCATCTATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-333s1c1
Sequence:CCGGCAAGTTCCCTAAGCATAGATACTCGAGTATCTATGCTTAGGGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-180s1c1
Sequence:CCGGCCAAGCGAAGGAGAGCATGATCTCGAGATCATGCTCTCCTTCGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-381s1c1
Sequence:CCGGCATCTCGAAGAAATGGTCCTACTCGAGTAGGACCATTTCTTCGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026401.1-345s1c1
Sequence:CCGGGCATAGATACATTGCAGACCACTCGAGTGGTCTGCAATGTATCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-179s21c1
Sequence:CCGGCCAAGCGAAGGAGAGCATGATCTCGAGATCATGCTCTCCTTCGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-332s21c1
Sequence:CCGGCAAGTTCCCTAAGCATAGATACTCGAGTATCTATGCTTAGGGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-380s21c1
Sequence:CCGGCATCTCGAAGAAATGGTCCTACTCGAGTAGGACCATTTCTTCGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026401.2-344s21c1
Sequence:CCGGGCATAGATACATTGCAGACCACTCGAGTGGTCTGCAATGTATCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)