EMAIL THIS PAGE TO A FRIEND

MRPL10

mitochondrial ribosomal protein L10

64 Gene Product Result for
Synonyms: L10MT MRP-L10 MRP-L8 MRPL8 RPML8
UniProtKB ID: Q7Z7H8, A6NGJ4, Q96B80, Q96Q55
Gene ID:
Human(124995) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified three transcript variants that encode two different isoforms. A pseudogene corresponding to this gene is found on chromosome 5q. [provided by RefSeq, Nov 2010]
Mouse(107732) mitochondrial ribosomal protein L10
Rat(691075) mitochondrial ribosomal protein L10
naked mole-rat(101699051) mitochondrial ribosomal protein L10
sheep(101118201) mitochondrial ribosomal protein L10
Zebrafish(541330) mitochondrial ribosomal protein L10
fruit fly(33182) mitochondrial ribosomal protein L10
dog(608696) mitochondrial ribosomal protein L10
cow(515014) mitochondrial ribosomal protein L10
domestic cat(101086017) mitochondrial ribosomal protein L10
chicken(426521) mitochondrial ribosomal protein L10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134621 MISSION® esiRNA esiRNA human MRPL10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145255 Rosetta Predictions human pricing
NM_148887 Rosetta Predictions human pricing
NM_001109620 Rosetta Predictions rat pricing
NM_026154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070323 predicted 753
2 SASI_Hs01_00070324 predicted 716
3 SASI_Hs01_00070325 predicted 343
4 SASI_Hs01_00070327 predicted 861
5 SASI_Hs02_00365108 predicted 304
6 SASI_Hs01_00070328 predicted 324
7 SASI_Hs01_00070329 predicted 752
8 SASI_Hs01_00070330 predicted 430
9 SASI_Hs01_00070331 predicted 575
10 SASI_Hs01_00070332 predicted 845
11 SASI_Hs01_00070326 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201847 predicted 859
2 SASI_Hs01_00201848 predicted 817
3 SASI_Hs01_00201849 predicted 441
4 SASI_Hs01_00201850 predicted 620
5 SASI_Hs01_00201851 predicted 965
6 SASI_Hs01_00201852 predicted 404
7 SASI_Hs01_00201853 predicted 421
8 SASI_Hs01_00201854 predicted 861
9 SASI_Hs01_00201855 predicted 534
10 SASI_Hs01_00201856 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250152 predicted 860
2 SASI_Rn02_00250153 predicted 522
3 SASI_Rn02_00250154 predicted 581
4 SASI_Rn02_00250155 predicted 1039
5 SASI_Rn02_00250156 predicted 1238
6 SASI_Rn02_00250157 predicted 936
7 SASI_Rn02_00250158 predicted 1143
8 SASI_Rn02_00250159 predicted 319
9 SASI_Rn02_00250160 predicted 1208
10 SASI_Rn02_00250161 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329769 predicted 856
2 SASI_Mm01_00098750 predicted 896
3 SASI_Mm01_00098751 predicted 259
4 SASI_Mm01_00098752 predicted 906
5 SASI_Mm01_00098753 predicted 735
6 SASI_Mm01_00098754 predicted 1002
7 SASI_Mm02_00329770 predicted 351
8 SASI_Mm01_00098755 predicted 1011
9 SASI_Mm01_00098756 predicted 903
10 SASI_Mm01_00098758 predicted 1065
11 SASI_Mm01_00098757 predicted 512
12 SASI_Mm01_00098759 predicted 791
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148887
VALIDATED
MRPL10 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_148887.1-448s1c1
Sequence:CCGGCAAGCTTCTTATGCGACACCACTCGAGTGGTGTCGCATAAGAAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-609s21c1
Sequence:CCGGAGGAGATGGTACGGATCTTAACTCGAGTTAAGATCCGTACCATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-393s21c1
Sequence:CCGGTCCAGGACAACCGAATGATAGCTCGAGCTATCATTCGGTTGTCCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148887.1-933s1c1
Sequence:CCGGCGCATAAATACACTCTGCGTTCTCGAGAACGCAGAGTGTATTTATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148887.1-663s1c1
Sequence:CCGGGCATTGATGACACCATCCTCACTCGAGTGAGGATGGTGTCATCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_148887.1-472s1c1
Sequence:CCGGGCGGAAACACAAGATCCTGATCTCGAGATCAGGATCTTGTGTTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-262s21c1
Sequence:CCGGGCTGATGGCTGTGACTGAATACTCGAGTATTCAGTCACAGCCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148887.1-921s21c1
Sequence:CCGGTAGCCAGCCCTGCGCATAAATCTCGAGATTTATGCGCAGGGCTGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-439s21c1
Sequence:CCGGTGCAGAGGACAAGCTTCTTATCTCGAGATAAGAAGCTTGTCCTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148887
VALIDATED
MRPL10 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_148887.1-448s1c1
Sequence:CCGGCAAGCTTCTTATGCGACACCACTCGAGTGGTGTCGCATAAGAAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-609s21c1
Sequence:CCGGAGGAGATGGTACGGATCTTAACTCGAGTTAAGATCCGTACCATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-393s21c1
Sequence:CCGGTCCAGGACAACCGAATGATAGCTCGAGCTATCATTCGGTTGTCCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148887.1-933s1c1
Sequence:CCGGCGCATAAATACACTCTGCGTTCTCGAGAACGCAGAGTGTATTTATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148887.1-663s1c1
Sequence:CCGGGCATTGATGACACCATCCTCACTCGAGTGAGGATGGTGTCATCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_148887.1-472s1c1
Sequence:CCGGGCGGAAACACAAGATCCTGATCTCGAGATCAGGATCTTGTGTTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-262s21c1
Sequence:CCGGGCTGATGGCTGTGACTGAATACTCGAGTATTCAGTCACAGCCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148887.1-921s21c1
Sequence:CCGGTAGCCAGCCCTGCGCATAAATCTCGAGATTTATGCGCAGGGCTGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-439s21c1
Sequence:CCGGTGCAGAGGACAAGCTTCTTATCTCGAGATAAGAAGCTTGTCCTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148887
VALIDATED
MRPL10 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_148887.1-448s1c1
Sequence:CCGGCAAGCTTCTTATGCGACACCACTCGAGTGGTGTCGCATAAGAAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-609s21c1
Sequence:CCGGAGGAGATGGTACGGATCTTAACTCGAGTTAAGATCCGTACCATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-393s21c1
Sequence:CCGGTCCAGGACAACCGAATGATAGCTCGAGCTATCATTCGGTTGTCCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148887.1-933s1c1
Sequence:CCGGCGCATAAATACACTCTGCGTTCTCGAGAACGCAGAGTGTATTTATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148887.1-663s1c1
Sequence:CCGGGCATTGATGACACCATCCTCACTCGAGTGAGGATGGTGTCATCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_148887.1-472s1c1
Sequence:CCGGGCGGAAACACAAGATCCTGATCTCGAGATCAGGATCTTGTGTTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-262s21c1
Sequence:CCGGGCTGATGGCTGTGACTGAATACTCGAGTATTCAGTCACAGCCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148887.1-921s21c1
Sequence:CCGGTAGCCAGCCCTGCGCATAAATCTCGAGATTTATGCGCAGGGCTGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148887.1-439s21c1
Sequence:CCGGTGCAGAGGACAAGCTTCTTATCTCGAGATAAGAAGCTTGTCCTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026154
MRPL10 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026154.1-262s1c1
Sequence:CCGGCGTCAAGATATAGTAGCAGTTCTCGAGAACTGCTACTATATCTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026154.1-363s1c1
Sequence:CCGGGCGGAAACACAAGATCTTCATCTCGAGATGAAGATCTTGTGTTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026154.1-156s21c1
Sequence:CCGGGATGGCTATAACTGAGTATATCTCGAGATATACTCAGTTATAGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026154.1-1324s1c1
Sequence:CCGGCCTCAAATTCTCAAAGTAGAACTCGAGTTCTACTTTGAGAATTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026154.1-156s1c1
Sequence:CCGGGATGGCTATAACTGAGTATATCTCGAGATATACTCAGTTATAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026154.1-1324s21c1
Sequence:CCGGCCTCAAATTCTCAAAGTAGAACTCGAGTTCTACTTTGAGAATTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026154.1-363s21c1
Sequence:CCGGGCGGAAACACAAGATCTTCATCTCGAGATGAAGATCTTGTGTTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026154.1-262s21c1
Sequence:CCGGCGTCAAGATATAGTAGCAGTTCTCGAGAACTGCTACTATATCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026154
MRPL10 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026154.1-262s1c1
Sequence:CCGGCGTCAAGATATAGTAGCAGTTCTCGAGAACTGCTACTATATCTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026154.1-363s1c1
Sequence:CCGGGCGGAAACACAAGATCTTCATCTCGAGATGAAGATCTTGTGTTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026154.1-156s21c1
Sequence:CCGGGATGGCTATAACTGAGTATATCTCGAGATATACTCAGTTATAGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026154.1-1324s1c1
Sequence:CCGGCCTCAAATTCTCAAAGTAGAACTCGAGTTCTACTTTGAGAATTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026154.1-156s1c1
Sequence:CCGGGATGGCTATAACTGAGTATATCTCGAGATATACTCAGTTATAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026154.1-1324s21c1
Sequence:CCGGCCTCAAATTCTCAAAGTAGAACTCGAGTTCTACTTTGAGAATTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026154.1-363s21c1
Sequence:CCGGGCGGAAACACAAGATCTTCATCTCGAGATGAAGATCTTGTGTTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026154.1-262s21c1
Sequence:CCGGCGTCAAGATATAGTAGCAGTTCTCGAGAACTGCTACTATATCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026154
MRPL10 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026154.1-262s1c1
Sequence:CCGGCGTCAAGATATAGTAGCAGTTCTCGAGAACTGCTACTATATCTTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026154.1-363s1c1
Sequence:CCGGGCGGAAACACAAGATCTTCATCTCGAGATGAAGATCTTGTGTTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026154.1-156s21c1
Sequence:CCGGGATGGCTATAACTGAGTATATCTCGAGATATACTCAGTTATAGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026154.1-1324s1c1
Sequence:CCGGCCTCAAATTCTCAAAGTAGAACTCGAGTTCTACTTTGAGAATTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026154.1-156s1c1
Sequence:CCGGGATGGCTATAACTGAGTATATCTCGAGATATACTCAGTTATAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026154.1-1324s21c1
Sequence:CCGGCCTCAAATTCTCAAAGTAGAACTCGAGTTCTACTTTGAGAATTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026154.1-363s21c1
Sequence:CCGGGCGGAAACACAAGATCTTCATCTCGAGATGAAGATCTTGTGTTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026154.1-262s21c1
Sequence:CCGGCGTCAAGATATAGTAGCAGTTCTCGAGAACTGCTACTATATCTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)