EMAIL THIS PAGE TO A FRIEND

MRPL11

mitochondrial ribosomal protein L11

95 Gene Product Result for
Synonyms: L11MT MRP-L11
UniProtKB ID: Q9Y3B7, A6NLT0, A8K219, Q32P46, Q96Q73
Gene ID:
Human(65003) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified three transcript variants that encode different isoforms. Pseudogenes corresponding to this gene are found on chromosomes 5q and 12q. [provided by RefSeq, Jul 2008]
Mouse(66419) mitochondrial ribosomal protein L11
Rat(293666) mitochondrial ribosomal protein L11
Zebrafish(436829) mitochondrial ribosomal protein L11
fruit fly(41757) mitochondrial ribosomal protein L11
cow(515990) mitochondrial ribosomal protein L11
Horse(100052531) mitochondrial ribosomal protein L11
domestic cat(101085318) mitochondrial ribosomal protein L11
dog(476012) mitochondrial ribosomal protein L11
Thale Cress(829701) mitochondrial ribosomal protein L11
Goat(100861367) mitochondrial ribosomal protein L11
sheep(101114224) mitochondrial ribosomal protein L11
domestic guinea pig(100715592) mitochondrial ribosomal protein L11
naked mole-rat(101723130) mitochondrial ribosomal protein L11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170738 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016050 Rosetta Predictions human pricing
NM_170738 Rosetta Predictions human pricing
NM_170739 Rosetta Predictions human pricing
NM_001006973 Rosetta Predictions rat pricing
NM_025553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348769 predicted 414
2 SASI_Hs02_00348770 predicted 1110
3 SASI_Hs02_00348771 predicted 492
4 SASI_Hs02_00348772 predicted 459
5 SASI_Hs02_00348773 predicted 1135
6 SASI_Hs02_00348774 predicted 869
7 SASI_Hs02_00348775 predicted 725
8 SASI_Hs02_00348776 predicted 421
9 SASI_Hs02_00348777 predicted 727
10 SASI_Hs01_00111143 predicted 266
11 SASI_Hs01_00111138 predicted 329
12 SASI_Hs01_00111139 predicted 300
13 SASI_Hs01_00111140 predicted 275
14 SASI_Hs01_00111141 predicted 208
15 SASI_Hs01_00111142 predicted 294
16 SASI_Hs01_00111144 predicted 205
17 SASI_Hs01_00111145 predicted 229
18 SASI_Hs01_00111146 predicted 325
19 SASI_Hs01_00111147 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166473 predicted 335
2 SASI_Hs02_00367690 predicted 1034
3 SASI_Hs01_00166474 predicted 412
4 SASI_Hs01_00166475 predicted 382
5 SASI_Hs02_00367691 predicted 1057
6 SASI_Hs02_00367692 predicted 793
7 SASI_Hs02_00367693 predicted 650
8 SASI_Hs02_00367694 predicted 130
9 SASI_Hs01_00166477 predicted 335
10 SASI_Hs02_00367695 predicted 646
11 SASI_Hs01_00166476 predicted 369
12 SASI_Hs01_00166478 predicted 355
13 SASI_Hs01_00166479 predicted 329
14 SASI_Hs01_00166480 predicted 483
15 SASI_Hs01_00166481 predicted 361
16 SASI_Hs01_00166482 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367696 predicted 465
2 SASI_Hs02_00367697 predicted 562
3 SASI_Hs02_00367698 predicted 912
4 SASI_Hs02_00367699 predicted 597
5 SASI_Hs02_00367700 predicted 413
6 SASI_Hs02_00367701 predicted 249
7 SASI_Hs02_00367702 predicted 547
8 SASI_Hs02_00367703 predicted 914
9 SASI_Hs02_00367704 predicted 560
10 SASI_Hs02_00367705 predicted 578
11 SASI_Hs01_00219372 predicted 332
12 SASI_Hs01_00219373 predicted 310
13 SASI_Hs01_00219374 predicted 270
14 SASI_Hs01_00219375 predicted 206
15 SASI_Hs01_00219376 predicted 300
16 SASI_Hs01_00219377 predicted 269
17 SASI_Hs01_00219378 predicted 208
18 SASI_Hs01_00219379 predicted 228
19 SASI_Hs01_00219380 predicted 330
20 SASI_Hs01_00219381 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043714 predicted 444
2 SASI_Rn01_00043715 predicted 255
3 SASI_Rn01_00043717 predicted 370
4 SASI_Rn01_00043718 predicted 399
5 SASI_Rn01_00043719 predicted 494
6 SASI_Rn01_00043720 predicted 388
7 SASI_Rn01_00043723 predicted 543
8 SASI_Rn02_00198531 predicted 388
9 SASI_Rn02_00198532 predicted 504
10 SASI_Rn02_00198533 predicted 254
11 SASI_Rn01_00043716 predicted 220
12 SASI_Rn01_00043721 predicted 223
13 SASI_Rn01_00043722 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085461 predicted 409
2 SASI_Mm01_00085462 predicted 406
3 SASI_Mm01_00085464 predicted 426
4 SASI_Mm01_00085465 predicted 296
5 SASI_Mm01_00085466 predicted 214
6 SASI_Mm02_00328497 predicted 440
7 SASI_Mm01_00085467 predicted 427
8 SASI_Mm01_00085468 predicted 219
9 SASI_Mm01_00085469 predicted 410
10 SASI_Mm02_00328498 predicted 485
11 SASI_Mm01_00085463 predicted 447
12 SASI_Mm01_00085470 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025553
VALIDATED
MRPL11 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-225s21c1
Sequence:CCGGCTGCAAAGAGTTCAACGAGAACTCGAGTTCTCGTTGAACTCTTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-409s21c1
Sequence:CCGGCTGGTGAGTTTGAAGCACGTACTCGAGTACGTGCTTCAAACTCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-328s21c1
Sequence:CCGGCAGCCCACTGTTTCTTACTTTCTCGAGAAAGTAAGAAACAGTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025553.3-664s21c1
Sequence:CCGGCTTTCTACACTCTGAGAATTTCTCGAGAAATTCTCAGAGTGTAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-204s21c1
Sequence:CCGGAGGTGTCTCTATCAACCAGTTCTCGAGAACTGGTTGATAGAGACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025553.1-665s1c1
Sequence:CCGGCTTTCTACACTCTGAGAATTTCTCGAGAAATTCTCAGAGTGTAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025553.1-329s1c1
Sequence:CCGGCAGCCCACTGTTTCTTACTTTCTCGAGAAAGTAAGAAACAGTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025553.1-205s1c1
Sequence:CCGGAGGTGTCTCTATCAACCAGTTCTCGAGAACTGGTTGATAGAGACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025553.1-410s1c1
Sequence:CCGGCTGGTGAGTTTGAAGCACGTACTCGAGTACGTGCTTCAAACTCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025553.1-226s1c1
Sequence:CCGGCTGCAAAGAGTTCAACGAGAACTCGAGTTCTCGTTGAACTCTTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025553
VALIDATED
MRPL11 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-225s21c1
Sequence:CCGGCTGCAAAGAGTTCAACGAGAACTCGAGTTCTCGTTGAACTCTTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-409s21c1
Sequence:CCGGCTGGTGAGTTTGAAGCACGTACTCGAGTACGTGCTTCAAACTCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-328s21c1
Sequence:CCGGCAGCCCACTGTTTCTTACTTTCTCGAGAAAGTAAGAAACAGTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025553.3-664s21c1
Sequence:CCGGCTTTCTACACTCTGAGAATTTCTCGAGAAATTCTCAGAGTGTAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-204s21c1
Sequence:CCGGAGGTGTCTCTATCAACCAGTTCTCGAGAACTGGTTGATAGAGACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025553.1-665s1c1
Sequence:CCGGCTTTCTACACTCTGAGAATTTCTCGAGAAATTCTCAGAGTGTAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025553.1-329s1c1
Sequence:CCGGCAGCCCACTGTTTCTTACTTTCTCGAGAAAGTAAGAAACAGTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025553.1-205s1c1
Sequence:CCGGAGGTGTCTCTATCAACCAGTTCTCGAGAACTGGTTGATAGAGACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025553.1-410s1c1
Sequence:CCGGCTGGTGAGTTTGAAGCACGTACTCGAGTACGTGCTTCAAACTCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025553.1-226s1c1
Sequence:CCGGCTGCAAAGAGTTCAACGAGAACTCGAGTTCTCGTTGAACTCTTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025553
VALIDATED
MRPL11 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-225s21c1
Sequence:CCGGCTGCAAAGAGTTCAACGAGAACTCGAGTTCTCGTTGAACTCTTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-409s21c1
Sequence:CCGGCTGGTGAGTTTGAAGCACGTACTCGAGTACGTGCTTCAAACTCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-328s21c1
Sequence:CCGGCAGCCCACTGTTTCTTACTTTCTCGAGAAAGTAAGAAACAGTGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025553.3-664s21c1
Sequence:CCGGCTTTCTACACTCTGAGAATTTCTCGAGAAATTCTCAGAGTGTAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025553.3-204s21c1
Sequence:CCGGAGGTGTCTCTATCAACCAGTTCTCGAGAACTGGTTGATAGAGACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025553.1-665s1c1
Sequence:CCGGCTTTCTACACTCTGAGAATTTCTCGAGAAATTCTCAGAGTGTAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025553.1-329s1c1
Sequence:CCGGCAGCCCACTGTTTCTTACTTTCTCGAGAAAGTAAGAAACAGTGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025553.1-205s1c1
Sequence:CCGGAGGTGTCTCTATCAACCAGTTCTCGAGAACTGGTTGATAGAGACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025553.1-410s1c1
Sequence:CCGGCTGGTGAGTTTGAAGCACGTACTCGAGTACGTGCTTCAAACTCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025553.1-226s1c1
Sequence:CCGGCTGCAAAGAGTTCAACGAGAACTCGAGTTCTCGTTGAACTCTTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170738
VALIDATED
MRPL11 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-473s21c1
Sequence:CCGGGTGAAGGACCTCAGTTCAGAACTCGAGTTCTGAACTGAGGTCCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-226s21c1
Sequence:CCGGGCCTGACAGGACATTTGAAATCTCGAGATTTCAAATGTCCTGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-159s21c1
Sequence:CCGGAGGAGTTCAATGAGAGGACAACTCGAGTTGTCCTCTCATTGAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170738.2-606s21c1
Sequence:CCGGCAGATTTCAAAGGAGGTAGTTCTCGAGAACTACCTCCTTTGAAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-368s21c1
Sequence:CCGGGCCCGCATCAAAGCTCAGGATCTCGAGATCCTGAGCTTTGATGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-600s1c1
Sequence:CCGGCAGATTTCAAAGGAGGTAGTTCTCGAGAACTACCTCCTTTGAAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-220s1c1
Sequence:CCGGGCCTGACAGGACATTTGAAATCTCGAGATTTCAAATGTCCTGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-467s1c1
Sequence:CCGGGTGAAGGACCTCAGTTCAGAACTCGAGTTCTGAACTGAGGTCCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-362s1c1
Sequence:CCGGGCCCGCATCAAAGCTCAGGATCTCGAGATCCTGAGCTTTGATGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-153s1c1
Sequence:CCGGAGGAGTTCAATGAGAGGACAACTCGAGTTGTCCTCTCATTGAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170738
VALIDATED
MRPL11 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-473s21c1
Sequence:CCGGGTGAAGGACCTCAGTTCAGAACTCGAGTTCTGAACTGAGGTCCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-226s21c1
Sequence:CCGGGCCTGACAGGACATTTGAAATCTCGAGATTTCAAATGTCCTGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-159s21c1
Sequence:CCGGAGGAGTTCAATGAGAGGACAACTCGAGTTGTCCTCTCATTGAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170738.2-606s21c1
Sequence:CCGGCAGATTTCAAAGGAGGTAGTTCTCGAGAACTACCTCCTTTGAAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-368s21c1
Sequence:CCGGGCCCGCATCAAAGCTCAGGATCTCGAGATCCTGAGCTTTGATGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-600s1c1
Sequence:CCGGCAGATTTCAAAGGAGGTAGTTCTCGAGAACTACCTCCTTTGAAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-220s1c1
Sequence:CCGGGCCTGACAGGACATTTGAAATCTCGAGATTTCAAATGTCCTGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-467s1c1
Sequence:CCGGGTGAAGGACCTCAGTTCAGAACTCGAGTTCTGAACTGAGGTCCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-362s1c1
Sequence:CCGGGCCCGCATCAAAGCTCAGGATCTCGAGATCCTGAGCTTTGATGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-153s1c1
Sequence:CCGGAGGAGTTCAATGAGAGGACAACTCGAGTTGTCCTCTCATTGAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170738
VALIDATED
MRPL11 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-473s21c1
Sequence:CCGGGTGAAGGACCTCAGTTCAGAACTCGAGTTCTGAACTGAGGTCCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-226s21c1
Sequence:CCGGGCCTGACAGGACATTTGAAATCTCGAGATTTCAAATGTCCTGTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-159s21c1
Sequence:CCGGAGGAGTTCAATGAGAGGACAACTCGAGTTGTCCTCTCATTGAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170738.2-606s21c1
Sequence:CCGGCAGATTTCAAAGGAGGTAGTTCTCGAGAACTACCTCCTTTGAAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170738.2-368s21c1
Sequence:CCGGGCCCGCATCAAAGCTCAGGATCTCGAGATCCTGAGCTTTGATGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-600s1c1
Sequence:CCGGCAGATTTCAAAGGAGGTAGTTCTCGAGAACTACCTCCTTTGAAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-220s1c1
Sequence:CCGGGCCTGACAGGACATTTGAAATCTCGAGATTTCAAATGTCCTGTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-467s1c1
Sequence:CCGGGTGAAGGACCTCAGTTCAGAACTCGAGTTCTGAACTGAGGTCCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-362s1c1
Sequence:CCGGGCCCGCATCAAAGCTCAGGATCTCGAGATCCTGAGCTTTGATGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_170738.1-153s1c1
Sequence:CCGGAGGAGTTCAATGAGAGGACAACTCGAGTTGTCCTCTCATTGAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)