EMAIL THIS PAGE TO A FRIEND

MRPL12

mitochondrial ribosomal protein L12

54 Gene Product Result for
Synonyms: 5c5-2 L12mt MRP-L31/34 MRPL7 MRPL7/L12 RPML12
UniProtKB ID: P52815, Q969U0, Q9HCA2, Q9UQJ3
Gene ID:
Human(6182) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein which forms homodimers. In prokaryotic ribosomes, two L7/L12 dimers and one L10 protein form the L8 protein complex. [provided by RefSeq, Jul 2008]
Mouse(56282) mitochondrial ribosomal protein L12
Rat(303746) mitochondrial ribosomal protein L12
Zebrafish(550391) mitochondrial ribosomal protein L12
cow(399560) mitochondrial ribosomal protein L12
domestic cat(101088965) mitochondrial ribosomal protein L12
dog(608030) mitochondrial ribosomal protein L12
chicken(769031) mitochondrial ribosomal protein L12
fruit fly(44326) mitochondrial ribosomal protein L12
naked mole-rat(101708031) mitochondrial ribosomal protein L12
domestic guinea pig(100713260) mitochondrial ribosomal protein L12
sheep(101116242) mitochondrial ribosomal protein L12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002949 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002949 Rosetta Predictions human pricing
NM_001029900 Rosetta Predictions rat pricing
NM_027204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334793 predicted 208
2 SASI_Hs01_00047216 predicted 342
3 SASI_Hs01_00047217 predicted 388
4 SASI_Hs01_00047218 predicted 507
5 SASI_Hs01_00047219 predicted 486
6 SASI_Hs01_00047220 predicted 483
7 SASI_Hs01_00047221 predicted 570
8 SASI_Hs01_00047222 predicted 492
9 SASI_Hs01_00047223 predicted 365
10 SASI_Hs01_00047224 predicted 601
11 SASI_Hs01_00047215 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071006 predicted 958
2 SASI_Rn01_00071007 predicted 613
3 SASI_Rn01_00071008 predicted 1222
4 SASI_Rn01_00071009 predicted 675
5 SASI_Rn01_00071010 predicted 500
6 SASI_Rn01_00071011 predicted 586
7 SASI_Rn01_00071012 predicted 920
8 SASI_Rn01_00071014 predicted 1309
9 SASI_Rn01_00071015 predicted 1123
10 SASI_Rn02_00203463 predicted 1081
11 SASI_Rn01_00071013 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134461 predicted 627
2 SASI_Mm01_00134464 predicted 634
3 SASI_Mm01_00134469 predicted 549
4 SASI_Mm01_00134470 predicted 606
5 SASI_Mm02_00331747 predicted 615
6 SASI_Mm01_00134463 predicted 433
7 SASI_Mm01_00134465 predicted 303
8 SASI_Mm01_00134466 predicted 251
9 SASI_Mm01_00134467 predicted 462
10 SASI_Mm02_00331748 predicted 426
11 SASI_Mm01_00134462 predicted 239
12 SASI_Mm01_00134468 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027204
VALIDATED
MRPL12 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-789s1c1
Sequence:CCGGGCAGTGACAACCTTTGCAGAACTCGAGTTCTGCAAAGGTTGTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027204.2-180s1c1
Sequence:CCGGCCTCTGGATAATGCTCCCAAACTCGAGTTTGGGAGCATTATCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-575s1c1
Sequence:CCGGCGAGAAGATCAAAGCAGCCTTCTCGAGAAGGCTGCTTTGATCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-270s1c1
Sequence:CCGGCTCAACGAACTCCTGAAGAAACTCGAGTTTCTTCAGGAGTTCGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-441s1c1
Sequence:CCGGGCAAAGCCTGTGGACAAAGTACTCGAGTACTTTGTCCACAGGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027204.2-789s21c1
Sequence:CCGGGCAGTGACAACCTTTGCAGAACTCGAGTTCTGCAAAGGTTGTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027204.2-575s21c1
Sequence:CCGGCGAGAAGATCAAAGCAGCCTTCTCGAGAAGGCTGCTTTGATCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027204.2-441s21c1
Sequence:CCGGGCAAAGCCTGTGGACAAAGTACTCGAGTACTTTGTCCACAGGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027204.2-270s21c1
Sequence:CCGGCTCAACGAACTCCTGAAGAAACTCGAGTTTCTTCAGGAGTTCGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027204
VALIDATED
MRPL12 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-789s1c1
Sequence:CCGGGCAGTGACAACCTTTGCAGAACTCGAGTTCTGCAAAGGTTGTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027204.2-180s1c1
Sequence:CCGGCCTCTGGATAATGCTCCCAAACTCGAGTTTGGGAGCATTATCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-575s1c1
Sequence:CCGGCGAGAAGATCAAAGCAGCCTTCTCGAGAAGGCTGCTTTGATCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-270s1c1
Sequence:CCGGCTCAACGAACTCCTGAAGAAACTCGAGTTTCTTCAGGAGTTCGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-441s1c1
Sequence:CCGGGCAAAGCCTGTGGACAAAGTACTCGAGTACTTTGTCCACAGGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027204.2-789s21c1
Sequence:CCGGGCAGTGACAACCTTTGCAGAACTCGAGTTCTGCAAAGGTTGTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027204.2-575s21c1
Sequence:CCGGCGAGAAGATCAAAGCAGCCTTCTCGAGAAGGCTGCTTTGATCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027204.2-441s21c1
Sequence:CCGGGCAAAGCCTGTGGACAAAGTACTCGAGTACTTTGTCCACAGGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027204.2-270s21c1
Sequence:CCGGCTCAACGAACTCCTGAAGAAACTCGAGTTTCTTCAGGAGTTCGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027204
VALIDATED
MRPL12 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-789s1c1
Sequence:CCGGGCAGTGACAACCTTTGCAGAACTCGAGTTCTGCAAAGGTTGTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027204.2-180s1c1
Sequence:CCGGCCTCTGGATAATGCTCCCAAACTCGAGTTTGGGAGCATTATCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-575s1c1
Sequence:CCGGCGAGAAGATCAAAGCAGCCTTCTCGAGAAGGCTGCTTTGATCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-270s1c1
Sequence:CCGGCTCAACGAACTCCTGAAGAAACTCGAGTTTCTTCAGGAGTTCGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027204.2-441s1c1
Sequence:CCGGGCAAAGCCTGTGGACAAAGTACTCGAGTACTTTGTCCACAGGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027204.2-789s21c1
Sequence:CCGGGCAGTGACAACCTTTGCAGAACTCGAGTTCTGCAAAGGTTGTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027204.2-575s21c1
Sequence:CCGGCGAGAAGATCAAAGCAGCCTTCTCGAGAAGGCTGCTTTGATCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027204.2-441s21c1
Sequence:CCGGGCAAAGCCTGTGGACAAAGTACTCGAGTACTTTGTCCACAGGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027204.2-270s21c1
Sequence:CCGGCTCAACGAACTCCTGAAGAAACTCGAGTTTCTTCAGGAGTTCGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002949
VALIDATED
MRPL12 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-567s1c1
Sequence:CCGGGAAATCAAGAACTACATCCAACTCGAGTTGGATGTAGTTCTTGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-341s1c1
Sequence:CCGGCAGCCTCACTCTCTTGGAAATCTCGAGATTTCCAAGAGAGTGAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-494s1c1
Sequence:CCGGAGCGAAAGAACGGACACATTTCTCGAGAAATGTGTCCGTTCTTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-223s1c1
Sequence:CCGGCCGTGCGACATATGAGGAGCACTCGAGTGCTCCTCATATGTCGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-572s1c1
Sequence:CCGGCAAGAACTACATCCAAGGCATCTCGAGATGCCTTGGATGTAGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-593s21c1
Sequence:CCGGCAACCTCGTCCAGGCAAAGAACTCGAGTTCTTTGCCTGGACGAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-821s21c1
Sequence:CCGGTGGAGCCGTTTGGGAGAATTGCTCGAGCAATTCTCCCAAACGGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-495s21c1
Sequence:CCGGGCGAAAGAACGGACACATTTCCTCGAGGAAATGTGTCCGTTCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-215s21c1
Sequence:CCGGTGTCTGTGCCGTGCGACATATCTCGAGATATGTCGCACGGCACAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-640s21c1
Sequence:CCGGTCAAAGCCAATGTCGCCAAAGCTCGAGCTTTGGCGACATTGGCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002949
VALIDATED
MRPL12 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-567s1c1
Sequence:CCGGGAAATCAAGAACTACATCCAACTCGAGTTGGATGTAGTTCTTGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-341s1c1
Sequence:CCGGCAGCCTCACTCTCTTGGAAATCTCGAGATTTCCAAGAGAGTGAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-494s1c1
Sequence:CCGGAGCGAAAGAACGGACACATTTCTCGAGAAATGTGTCCGTTCTTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-223s1c1
Sequence:CCGGCCGTGCGACATATGAGGAGCACTCGAGTGCTCCTCATATGTCGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-572s1c1
Sequence:CCGGCAAGAACTACATCCAAGGCATCTCGAGATGCCTTGGATGTAGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-593s21c1
Sequence:CCGGCAACCTCGTCCAGGCAAAGAACTCGAGTTCTTTGCCTGGACGAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-821s21c1
Sequence:CCGGTGGAGCCGTTTGGGAGAATTGCTCGAGCAATTCTCCCAAACGGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-495s21c1
Sequence:CCGGGCGAAAGAACGGACACATTTCCTCGAGGAAATGTGTCCGTTCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-215s21c1
Sequence:CCGGTGTCTGTGCCGTGCGACATATCTCGAGATATGTCGCACGGCACAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-640s21c1
Sequence:CCGGTCAAAGCCAATGTCGCCAAAGCTCGAGCTTTGGCGACATTGGCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002949
VALIDATED
MRPL12 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-567s1c1
Sequence:CCGGGAAATCAAGAACTACATCCAACTCGAGTTGGATGTAGTTCTTGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-341s1c1
Sequence:CCGGCAGCCTCACTCTCTTGGAAATCTCGAGATTTCCAAGAGAGTGAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-494s1c1
Sequence:CCGGAGCGAAAGAACGGACACATTTCTCGAGAAATGTGTCCGTTCTTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-223s1c1
Sequence:CCGGCCGTGCGACATATGAGGAGCACTCGAGTGCTCCTCATATGTCGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002949.2-572s1c1
Sequence:CCGGCAAGAACTACATCCAAGGCATCTCGAGATGCCTTGGATGTAGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-593s21c1
Sequence:CCGGCAACCTCGTCCAGGCAAAGAACTCGAGTTCTTTGCCTGGACGAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-821s21c1
Sequence:CCGGTGGAGCCGTTTGGGAGAATTGCTCGAGCAATTCTCCCAAACGGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-495s21c1
Sequence:CCGGGCGAAAGAACGGACACATTTCCTCGAGGAAATGTGTCCGTTCTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-215s21c1
Sequence:CCGGTGTCTGTGCCGTGCGACATATCTCGAGATATGTCGCACGGCACAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002949.2-640s21c1
Sequence:CCGGTCAAAGCCAATGTCGCCAAAGCTCGAGCTTTGGCGACATTGGCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)