EMAIL THIS PAGE TO A FRIEND

MRPL13

mitochondrial ribosomal protein L13

52 Gene Product Result for
Synonyms: L13 L13A L13mt RPL13 RPML13
UniProtKB ID: Q9BYD1, B2R4R8, Q9UI04
Gene ID:
Human(28998) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(68537) mitochondrial ribosomal protein L13
Rat(299938) mitochondrial ribosomal protein L13
sheep(101121019) mitochondrial ribosomal protein L13
domestic guinea pig(100725173) mitochondrial ribosomal protein L13
naked mole-rat(101714629) mitochondrial ribosomal protein L13
Zebrafish(553555) mitochondrial ribosomal protein L13
fruit fly(35145) mitochondrial ribosomal protein L13
chicken(420356) mitochondrial ribosomal protein L13
domestic cat(101082376) mitochondrial ribosomal protein L13
cow(617901) mitochondrial ribosomal protein L13
dog(482029) mitochondrial ribosomal protein L13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014078 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014078 Rosetta Predictions human pricing
NM_001006985 Rosetta Predictions rat pricing
NM_026759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044180 predicted 706
2 SASI_Hs02_00345106 predicted 710
3 SASI_Hs01_00044181 predicted 553
4 SASI_Hs01_00044182 predicted 606
5 SASI_Hs01_00044184 predicted 398
6 SASI_Hs01_00044185 predicted 739
7 SASI_Hs01_00044186 predicted 773
8 SASI_Hs01_00044187 predicted 413
9 SASI_Hs01_00044189 predicted 493
10 SASI_Hs02_00345107 predicted 468
11 SASI_Hs01_00044183 predicted 678
12 SASI_Hs01_00044188 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032521 predicted 401
2 SASI_Rn02_00198557 predicted 361
3 SASI_Rn02_00198558 predicted 324
4 SASI_Rn01_00032522 predicted 290
5 SASI_Rn01_00032524 predicted 482
6 SASI_Rn01_00032525 predicted 297
7 SASI_Rn01_00032526 predicted 453
8 SASI_Rn01_00032527 predicted 312
9 SASI_Rn01_00032528 predicted 257
10 SASI_Rn01_00032529 predicted 395
11 SASI_Rn01_00032523 predicted 273
12 SASI_Rn01_00032530 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330812 predicted 421
2 SASI_Mm01_00050043 predicted 204
3 SASI_Mm01_00050045 predicted 528
4 SASI_Mm02_00330813 predicted 276
5 SASI_Mm01_00050046 predicted 267
6 SASI_Mm01_00050047 predicted 563
7 SASI_Mm01_00050048 predicted 420
8 SASI_Mm01_00050049 predicted 333
9 SASI_Mm01_00050051 predicted 407
10 SASI_Mm01_00050052 predicted 480
11 SASI_Mm01_00050044 predicted 280
12 SASI_Mm01_00050050 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014078
VALIDATED
MRPL13 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-440s21c1
Sequence:CCGGCATAAACCTGTGTACCATGCACTCGAGTGCATGGTACACAGGTTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-603s21c1
Sequence:CCGGTGAGGGATCCAGTGGCAATTGCTCGAGCAATTGCCACTGGATCCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-474s21c1
Sequence:CCGGGGGATCATGTTGTTATAATGACTCGAGTCATTATAACAACATGATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-764s21c1
Sequence:CCGGATACCTAAACGTCTAGATGAGCTCGAGCTCATCTAGACGTTTAGGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014078.4-416s1c1
Sequence:CCGGGCATCTATAAGACTTCAGGGACTCGAGTCCCTGAAGTCTTATAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014078.4-940s1c1
Sequence:CCGGGCTACAGTTCAGCACCTGTTTCTCGAGAAACAGGTGCTGAACTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014078.4-827s1c1
Sequence:CCGGCCACCTGAAGATTATCGGCTACTCGAGTAGCCGATAATCTTCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014078.4-356s1c1
Sequence:CCGGGCTAGAATATGGTATCTCTTACTCGAGTAAGAGATACCATATTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014078.4-564s1c1
Sequence:CCGGCAGGTGGATTTAGACAAGTAACTCGAGTTACTTGTCTAAATCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014078
VALIDATED
MRPL13 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-440s21c1
Sequence:CCGGCATAAACCTGTGTACCATGCACTCGAGTGCATGGTACACAGGTTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-603s21c1
Sequence:CCGGTGAGGGATCCAGTGGCAATTGCTCGAGCAATTGCCACTGGATCCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-474s21c1
Sequence:CCGGGGGATCATGTTGTTATAATGACTCGAGTCATTATAACAACATGATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-764s21c1
Sequence:CCGGATACCTAAACGTCTAGATGAGCTCGAGCTCATCTAGACGTTTAGGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014078.4-416s1c1
Sequence:CCGGGCATCTATAAGACTTCAGGGACTCGAGTCCCTGAAGTCTTATAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014078.4-940s1c1
Sequence:CCGGGCTACAGTTCAGCACCTGTTTCTCGAGAAACAGGTGCTGAACTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014078.4-827s1c1
Sequence:CCGGCCACCTGAAGATTATCGGCTACTCGAGTAGCCGATAATCTTCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014078.4-356s1c1
Sequence:CCGGGCTAGAATATGGTATCTCTTACTCGAGTAAGAGATACCATATTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014078.4-564s1c1
Sequence:CCGGCAGGTGGATTTAGACAAGTAACTCGAGTTACTTGTCTAAATCCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014078
VALIDATED
MRPL13 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-440s21c1
Sequence:CCGGCATAAACCTGTGTACCATGCACTCGAGTGCATGGTACACAGGTTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-603s21c1
Sequence:CCGGTGAGGGATCCAGTGGCAATTGCTCGAGCAATTGCCACTGGATCCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-474s21c1
Sequence:CCGGGGGATCATGTTGTTATAATGACTCGAGTCATTATAACAACATGATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014078.4-764s21c1
Sequence:CCGGATACCTAAACGTCTAGATGAGCTCGAGCTCATCTAGACGTTTAGGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014078.4-416s1c1
Sequence:CCGGGCATCTATAAGACTTCAGGGACTCGAGTCCCTGAAGTCTTATAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014078.4-940s1c1
Sequence:CCGGGCTACAGTTCAGCACCTGTTTCTCGAGAAACAGGTGCTGAACTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014078.4-827s1c1
Sequence:CCGGCCACCTGAAGATTATCGGCTACTCGAGTAGCCGATAATCTTCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014078.4-356s1c1
Sequence:CCGGGCTAGAATATGGTATCTCTTACTCGAGTAAGAGATACCATATTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014078.4-564s1c1
Sequence:CCGGCAGGTGGATTTAGACAAGTAACTCGAGTTACTTGTCTAAATCCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026759
VALIDATED
MRPL13 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026759.3-598s21c1
Sequence:CCGGGACTGAATGTTTCCTGAAGTACTCGAGTACTTCAGGAAACATTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-333s21c1
Sequence:CCGGCGATTGTGAAATTGGCTATTTCTCGAGAAATAGCCAATTTCACAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-110s21c1
Sequence:CCGGCCTGGCAAACTTGCGGTTATACTCGAGTATAACCGCAAGTTTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-428s21c1
Sequence:CCGGCCGGAAGATATTCTTAAGAATCTCGAGATTCTTAAGAATATCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026759.2-599s1c1
Sequence:CCGGGACTGAATGTTTCCTGAAGTACTCGAGTACTTCAGGAAACATTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026759.2-429s1c1
Sequence:CCGGCCGGAAGATATTCTTAAGAATCTCGAGATTCTTAAGAATATCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026759.2-111s1c1
Sequence:CCGGCCTGGCAAACTTGCGGTTATACTCGAGTATAACCGCAAGTTTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026759.2-334s1c1
Sequence:CCGGCGATTGTGAAATTGGCTATTTCTCGAGAAATAGCCAATTTCACAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026759.2-418s1c1
Sequence:CCGGACGAGGATATTCCGGAAGATACTCGAGTATCTTCCGGAATATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-417s21c1
Sequence:CCGGACGAGGATATTCCGGAAGATACTCGAGTATCTTCCGGAATATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026759
VALIDATED
MRPL13 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026759.3-598s21c1
Sequence:CCGGGACTGAATGTTTCCTGAAGTACTCGAGTACTTCAGGAAACATTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-333s21c1
Sequence:CCGGCGATTGTGAAATTGGCTATTTCTCGAGAAATAGCCAATTTCACAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-110s21c1
Sequence:CCGGCCTGGCAAACTTGCGGTTATACTCGAGTATAACCGCAAGTTTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-428s21c1
Sequence:CCGGCCGGAAGATATTCTTAAGAATCTCGAGATTCTTAAGAATATCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026759.2-599s1c1
Sequence:CCGGGACTGAATGTTTCCTGAAGTACTCGAGTACTTCAGGAAACATTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026759.2-429s1c1
Sequence:CCGGCCGGAAGATATTCTTAAGAATCTCGAGATTCTTAAGAATATCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026759.2-111s1c1
Sequence:CCGGCCTGGCAAACTTGCGGTTATACTCGAGTATAACCGCAAGTTTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026759.2-334s1c1
Sequence:CCGGCGATTGTGAAATTGGCTATTTCTCGAGAAATAGCCAATTTCACAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026759.2-418s1c1
Sequence:CCGGACGAGGATATTCCGGAAGATACTCGAGTATCTTCCGGAATATCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-417s21c1
Sequence:CCGGACGAGGATATTCCGGAAGATACTCGAGTATCTTCCGGAATATCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026759
VALIDATED
MRPL13 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026759.3-598s21c1
Sequence:CCGGGACTGAATGTTTCCTGAAGTACTCGAGTACTTCAGGAAACATTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-333s21c1
Sequence:CCGGCGATTGTGAAATTGGCTATTTCTCGAGAAATAGCCAATTTCACAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-110s21c1
Sequence:CCGGCCTGGCAAACTTGCGGTTATACTCGAGTATAACCGCAAGTTTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-428s21c1
Sequence:CCGGCCGGAAGATATTCTTAAGAATCTCGAGATTCTTAAGAATATCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026759.2-599s1c1
Sequence:CCGGGACTGAATGTTTCCTGAAGTACTCGAGTACTTCAGGAAACATTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026759.2-429s1c1
Sequence:CCGGCCGGAAGATATTCTTAAGAATCTCGAGATTCTTAAGAATATCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026759.2-111s1c1
Sequence:CCGGCCTGGCAAACTTGCGGTTATACTCGAGTATAACCGCAAGTTTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026759.2-334s1c1
Sequence:CCGGCGATTGTGAAATTGGCTATTTCTCGAGAAATAGCCAATTTCACAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026759.2-418s1c1
Sequence:CCGGACGAGGATATTCCGGAAGATACTCGAGTATCTTCCGGAATATCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026759.3-417s21c1
Sequence:CCGGACGAGGATATTCCGGAAGATACTCGAGTATCTTCCGGAATATCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)