EMAIL THIS PAGE TO A FRIEND

MRPL14

mitochondrial ribosomal protein L14

53 Gene Product Result for
Synonyms: L14mt L32mt MRP-L14 MRP-L32 MRPL32 RMPL32 RPML32
UniProtKB ID: Q6P1L8, B2R575, Q96Q72
Gene ID:
Human(64928) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found at 17p13.3. [provided by RefSeq, Jul 2008]
Mouse(68463) mitochondrial ribosomal protein L14
Rat(301250) mitochondrial ribosomal protein L14
Zebrafish(394122) mitochondrial ribosomal protein L14
cow(614579) mitochondrial ribosomal protein L14
domestic cat(101094926) mitochondrial ribosomal protein L14
dog(474918) mitochondrial ribosomal protein L14
fruit fly(31222) mitochondrial ribosomal protein L14
chicken(421443) mitochondrial ribosomal protein L14
naked mole-rat(101704666) mitochondrial ribosomal protein L14
domestic guinea pig(100712940) mitochondrial ribosomal protein L14
Goat(100861004) mitochondrial ribosomal protein L14
sheep(101117023) mitochondrial ribosomal protein L14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032111 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136931 MISSION® esiRNA esiRNA human MRPL14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032111 Rosetta Predictions human pricing
NM_001106890 Rosetta Predictions rat pricing
NM_026732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144277 predicted 327
2 SASI_Hs01_00144278 predicted 428
3 SASI_Hs01_00144279 predicted 346
4 SASI_Hs01_00144280 predicted 516
5 SASI_Hs01_00144281 predicted 206
6 SASI_Hs01_00144282 predicted 237
7 SASI_Hs01_00144283 predicted 206
8 SASI_Hs01_00144284 predicted 446
9 SASI_Hs01_00144285 predicted 543
10 SASI_Hs01_00144286 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223416 predicted 415
2 SASI_Rn02_00223417 predicted 403
3 SASI_Rn02_00223418 predicted 292
4 SASI_Rn02_00223419 predicted 437
5 SASI_Rn02_00223420 predicted 299
6 SASI_Rn02_00223421 predicted 380
7 SASI_Rn02_00223422 predicted 394
8 SASI_Rn02_00223423 predicted 429
9 SASI_Rn02_00223424 predicted 416
10 SASI_Rn02_00223425 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134780 predicted 235
2 SASI_Mm01_00134781 predicted 242
3 SASI_Mm01_00134782 predicted 236
4 SASI_Mm01_00134783 predicted 240
5 SASI_Mm01_00134784 predicted 343
6 SASI_Mm01_00134785 predicted 326
7 SASI_Mm01_00134786 predicted 342
8 SASI_Mm01_00134787 predicted 366
9 SASI_Mm01_00134788 predicted 240
10 SASI_Mm01_00134789 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026732
VALIDATED
MRPL14 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L14
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026732.2-394s1c1
Sequence:CCGGCCTCATTGAGGACAATGGCAACTCGAGTTGCCATTGTCCTCAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-373s1c1
Sequence:CCGGGTTTGACTCCAACAACGTGGTCTCGAGACCACGTTGTTGGAGTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-492s1c1
Sequence:CCGGCCATCGCTCAGAACTTTGTGTCTCGAGACACAAAGTTCTGAGCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-246s1c1
Sequence:CCGGGCATCCACGTCTATAACAAGACTCGAGTCTTGTTATAGACGTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-313s1c1
Sequence:CCGGGCAGAAGAAGAAAGCACTCATCTCGAGATGAGTGCTTTCTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-244s1c1
Sequence:CCGGGTGCATCCACGTCTATAACAACTCGAGTTGTTATAGACGTGGATGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-313s21c1
Sequence:CCGGGCAGAAGAAGAAAGCACTCATCTCGAGATGAGTGCTTTCTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-246s21c1
Sequence:CCGGGCATCCACGTCTATAACAAGACTCGAGTCTTGTTATAGACGTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-112s21c1
Sequence:CCGGCCATGTCAGCAGAGCATTCAGCTCGAGCTGAATGCTCTGCTGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-460s21c1
Sequence:CCGGCAGAAGGGAAGGAGAGTATTCCTCGAGGAATACTCTCCTTCCCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-373s21c1
Sequence:CCGGGTTTGACTCCAACAACGTGGTCTCGAGACCACGTTGTTGGAGTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026732
VALIDATED
MRPL14 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L14
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026732.2-394s1c1
Sequence:CCGGCCTCATTGAGGACAATGGCAACTCGAGTTGCCATTGTCCTCAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-373s1c1
Sequence:CCGGGTTTGACTCCAACAACGTGGTCTCGAGACCACGTTGTTGGAGTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-492s1c1
Sequence:CCGGCCATCGCTCAGAACTTTGTGTCTCGAGACACAAAGTTCTGAGCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-246s1c1
Sequence:CCGGGCATCCACGTCTATAACAAGACTCGAGTCTTGTTATAGACGTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-313s1c1
Sequence:CCGGGCAGAAGAAGAAAGCACTCATCTCGAGATGAGTGCTTTCTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-244s1c1
Sequence:CCGGGTGCATCCACGTCTATAACAACTCGAGTTGTTATAGACGTGGATGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-313s21c1
Sequence:CCGGGCAGAAGAAGAAAGCACTCATCTCGAGATGAGTGCTTTCTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-246s21c1
Sequence:CCGGGCATCCACGTCTATAACAAGACTCGAGTCTTGTTATAGACGTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-112s21c1
Sequence:CCGGCCATGTCAGCAGAGCATTCAGCTCGAGCTGAATGCTCTGCTGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-460s21c1
Sequence:CCGGCAGAAGGGAAGGAGAGTATTCCTCGAGGAATACTCTCCTTCCCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-373s21c1
Sequence:CCGGGTTTGACTCCAACAACGTGGTCTCGAGACCACGTTGTTGGAGTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026732
VALIDATED
MRPL14 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L14
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026732.2-394s1c1
Sequence:CCGGCCTCATTGAGGACAATGGCAACTCGAGTTGCCATTGTCCTCAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-373s1c1
Sequence:CCGGGTTTGACTCCAACAACGTGGTCTCGAGACCACGTTGTTGGAGTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-492s1c1
Sequence:CCGGCCATCGCTCAGAACTTTGTGTCTCGAGACACAAAGTTCTGAGCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-246s1c1
Sequence:CCGGGCATCCACGTCTATAACAAGACTCGAGTCTTGTTATAGACGTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-313s1c1
Sequence:CCGGGCAGAAGAAGAAAGCACTCATCTCGAGATGAGTGCTTTCTTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026732.2-244s1c1
Sequence:CCGGGTGCATCCACGTCTATAACAACTCGAGTTGTTATAGACGTGGATGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-313s21c1
Sequence:CCGGGCAGAAGAAGAAAGCACTCATCTCGAGATGAGTGCTTTCTTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-246s21c1
Sequence:CCGGGCATCCACGTCTATAACAAGACTCGAGTCTTGTTATAGACGTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-112s21c1
Sequence:CCGGCCATGTCAGCAGAGCATTCAGCTCGAGCTGAATGCTCTGCTGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-460s21c1
Sequence:CCGGCAGAAGGGAAGGAGAGTATTCCTCGAGGAATACTCTCCTTCCCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026732.2-373s21c1
Sequence:CCGGGTTTGACTCCAACAACGTGGTCTCGAGACCACGTTGTTGGAGTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032111
VALIDATED
MRPL14 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L14
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032111.2-210s1c1
Sequence:CCGGGAGTCTGAGTGCGATTCAGAACTCGAGTTCTGAATCGCACTCAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032111.2-584s21c1
Sequence:CCGGTGGTTGCAGGACTCGTGAATGCTCGAGCATTCACGAGTCCTGCAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032111.2-542s21c1
Sequence:CCGGTGGCCATTGCTCAGAACTTTGCTCGAGCAAAGTTCTGAGCAATGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032111.2-512s21c1
Sequence:CCGGGCAAGCGGGAAGGCGAGTATTCTCGAGAATACTCGCCTTCCCGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_032111.2-294s21c1
Sequence:CCGGTCGCTGCATCCATGTCTATAACTCGAGTTATAGACATGGATGCAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032111.2-178s21c1
Sequence:CCGGGTGCTGAGCCATCACTGTTTCCTCGAGGAAACAGTGATGGCTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032111
VALIDATED
MRPL14 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L14
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032111.2-210s1c1
Sequence:CCGGGAGTCTGAGTGCGATTCAGAACTCGAGTTCTGAATCGCACTCAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032111.2-584s21c1
Sequence:CCGGTGGTTGCAGGACTCGTGAATGCTCGAGCATTCACGAGTCCTGCAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032111.2-542s21c1
Sequence:CCGGTGGCCATTGCTCAGAACTTTGCTCGAGCAAAGTTCTGAGCAATGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032111.2-512s21c1
Sequence:CCGGGCAAGCGGGAAGGCGAGTATTCTCGAGAATACTCGCCTTCCCGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_032111.2-294s21c1
Sequence:CCGGTCGCTGCATCCATGTCTATAACTCGAGTTATAGACATGGATGCAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032111.2-178s21c1
Sequence:CCGGGTGCTGAGCCATCACTGTTTCCTCGAGGAAACAGTGATGGCTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032111
VALIDATED
MRPL14 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L14
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032111.2-210s1c1
Sequence:CCGGGAGTCTGAGTGCGATTCAGAACTCGAGTTCTGAATCGCACTCAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032111.2-584s21c1
Sequence:CCGGTGGTTGCAGGACTCGTGAATGCTCGAGCATTCACGAGTCCTGCAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032111.2-542s21c1
Sequence:CCGGTGGCCATTGCTCAGAACTTTGCTCGAGCAAAGTTCTGAGCAATGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032111.2-512s21c1
Sequence:CCGGGCAAGCGGGAAGGCGAGTATTCTCGAGAATACTCGCCTTCCCGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_032111.2-294s21c1
Sequence:CCGGTCGCTGCATCCATGTCTATAACTCGAGTTATAGACATGGATGCAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032111.2-178s21c1
Sequence:CCGGGTGCTGAGCCATCACTGTTTCCTCGAGGAAACAGTGATGGCTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)