EMAIL THIS PAGE TO A FRIEND

MRPL16

mitochondrial ribosomal protein L16

58 Gene Product Result for
Synonyms: L16mt MRP-L16
UniProtKB ID: Q9NX20, Q9BYD0, Q9HB70
Gene ID:
Human(54948) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(94063) mitochondrial ribosomal protein L16
Rat(293754) mitochondrial ribosomal protein L16
Zebrafish(493604) mitochondrial ribosomal protein L16
cow(538054) mitochondrial ribosomal protein L16
domestic cat(101099400) mitochondrial ribosomal protein L16
dog(476898) mitochondrial ribosomal protein L16
chicken(428840) mitochondrial ribosomal protein L16
fruit fly(31150) mitochondrial ribosomal protein L16
naked mole-rat(101705030) mitochondrial ribosomal protein L16
domestic guinea pig(100735716) mitochondrial ribosomal protein L16
sheep(101113699) mitochondrial ribosomal protein L16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017840 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045411 MISSION® esiRNA esiRNA human MRPL16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017840 Rosetta Predictions human pricing
NM_001009647 Rosetta Predictions rat pricing
NM_025606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037549 predicted 872
2 SASI_Hs01_00037550 predicted 790
3 SASI_Hs01_00037551 predicted 444
4 SASI_Hs01_00037552 predicted 693
5 SASI_Hs01_00037553 predicted 787
6 SASI_Hs01_00037555 predicted 896
7 SASI_Hs01_00037556 predicted 887
8 SASI_Hs01_00037557 predicted 771
9 SASI_Hs02_00350724 predicted 901
10 SASI_Hs02_00350725 predicted 885
11 SASI_Hs01_00037554 predicted 332
12 SASI_Hs01_00037558 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045840 predicted 744
2 SASI_Rn01_00045841 predicted 213
3 SASI_Rn01_00045842 predicted 754
4 SASI_Rn01_00045843 predicted 769
5 SASI_Rn01_00045844 predicted 384
6 SASI_Rn01_00045845 predicted 845
7 SASI_Rn01_00045846 predicted 502
8 SASI_Rn01_00045847 predicted 420
9 SASI_Rn01_00045848 predicted 220
10 SASI_Rn01_00045849 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185364 predicted 389
2 SASI_Mm01_00185366 predicted 293
3 SASI_Mm01_00185368 predicted 259
4 SASI_Mm01_00185372 predicted 358
5 SASI_Mm01_00185373 predicted 633
6 SASI_Mm01_00185370 predicted 479
7 SASI_Mm02_00328637 predicted 276
8 SASI_Mm02_00328638 predicted 743
9 SASI_Mm02_00328639 predicted 376
10 SASI_Mm02_00328640 predicted 485
11 SASI_Mm01_00185365 predicted 725
12 SASI_Mm01_00185367 predicted 736
13 SASI_Mm01_00185369 predicted 492
14 SASI_Mm01_00185371 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025606
VALIDATED
MRPL16 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L16
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025606.2-749s1c1
Sequence:CCGGCCATATGACTTGACGCAGAAACTCGAGTTTCTGCGTCAAGTCATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025606.2-372s1c1
Sequence:CCGGGCTTGACAATCAACCGCTTTACTCGAGTAAAGCGGTTGATTGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025606.2-972s1c1
Sequence:CCGGCCTCAGGGTACAACTTCTCTTCTCGAGAAGAGAAGTTGTACCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025606.2-580s1c1
Sequence:CCGGCCTGAACCAAGTTGCTCACAACTCGAGTTGTGAGCAACTTGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025606.2-187s1c1
Sequence:CCGGCCCTGAAAGGTCCAAGCTTAACTCGAGTTAAGCTTGGACCTTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-187s21c1
Sequence:CCGGCCCTGAAAGGTCCAAGCTTAACTCGAGTTAAGCTTGGACCTTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-580s21c1
Sequence:CCGGCCTGAACCAAGTTGCTCACAACTCGAGTTGTGAGCAACTTGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-749s21c1
Sequence:CCGGCCATATGACTTGACGCAGAAACTCGAGTTTCTGCGTCAAGTCATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-372s21c1
Sequence:CCGGGCTTGACAATCAACCGCTTTACTCGAGTAAAGCGGTTGATTGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025606.3-972s21c1
Sequence:CCGGCCTCAGGGTACAACTTCTCTTCTCGAGAAGAGAAGTTGTACCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025606
VALIDATED
MRPL16 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L16
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025606.2-749s1c1
Sequence:CCGGCCATATGACTTGACGCAGAAACTCGAGTTTCTGCGTCAAGTCATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025606.2-372s1c1
Sequence:CCGGGCTTGACAATCAACCGCTTTACTCGAGTAAAGCGGTTGATTGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025606.2-972s1c1
Sequence:CCGGCCTCAGGGTACAACTTCTCTTCTCGAGAAGAGAAGTTGTACCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025606.2-580s1c1
Sequence:CCGGCCTGAACCAAGTTGCTCACAACTCGAGTTGTGAGCAACTTGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025606.2-187s1c1
Sequence:CCGGCCCTGAAAGGTCCAAGCTTAACTCGAGTTAAGCTTGGACCTTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-187s21c1
Sequence:CCGGCCCTGAAAGGTCCAAGCTTAACTCGAGTTAAGCTTGGACCTTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-580s21c1
Sequence:CCGGCCTGAACCAAGTTGCTCACAACTCGAGTTGTGAGCAACTTGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-749s21c1
Sequence:CCGGCCATATGACTTGACGCAGAAACTCGAGTTTCTGCGTCAAGTCATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-372s21c1
Sequence:CCGGGCTTGACAATCAACCGCTTTACTCGAGTAAAGCGGTTGATTGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025606.3-972s21c1
Sequence:CCGGCCTCAGGGTACAACTTCTCTTCTCGAGAAGAGAAGTTGTACCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025606
VALIDATED
MRPL16 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L16
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025606.2-749s1c1
Sequence:CCGGCCATATGACTTGACGCAGAAACTCGAGTTTCTGCGTCAAGTCATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025606.2-372s1c1
Sequence:CCGGGCTTGACAATCAACCGCTTTACTCGAGTAAAGCGGTTGATTGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025606.2-972s1c1
Sequence:CCGGCCTCAGGGTACAACTTCTCTTCTCGAGAAGAGAAGTTGTACCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025606.2-580s1c1
Sequence:CCGGCCTGAACCAAGTTGCTCACAACTCGAGTTGTGAGCAACTTGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025606.2-187s1c1
Sequence:CCGGCCCTGAAAGGTCCAAGCTTAACTCGAGTTAAGCTTGGACCTTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-187s21c1
Sequence:CCGGCCCTGAAAGGTCCAAGCTTAACTCGAGTTAAGCTTGGACCTTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-580s21c1
Sequence:CCGGCCTGAACCAAGTTGCTCACAACTCGAGTTGTGAGCAACTTGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-749s21c1
Sequence:CCGGCCATATGACTTGACGCAGAAACTCGAGTTTCTGCGTCAAGTCATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025606.3-372s21c1
Sequence:CCGGGCTTGACAATCAACCGCTTTACTCGAGTAAAGCGGTTGATTGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025606.3-972s21c1
Sequence:CCGGCCTCAGGGTACAACTTCTCTTCTCGAGAAGAGAAGTTGTACCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017840
VALIDATED
MRPL16 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L16
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-302s1c1
Sequence:CCGGGTAAAGACACTGCTCCCAGTACTCGAGTACTGGGAGCAGTGTCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-332s1c1
Sequence:CCGGGAAGATGTTTCCATTCCTGAACTCGAGTTCAGGAATGGAAACATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-446s1c1
Sequence:CCGGGAAGCTACGGAGTTTACAGAACTCGAGTTCTGTAAACTCCGTAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-1001s1c1
Sequence:CCGGCTGAAAGAAGGATTCTGCATTCTCGAGAATGCAGAATCCTTCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017840.2-1046s1c1
Sequence:CCGGGAAGTCTTTGGGTAGCTCTTACTCGAGTAAGAGCTACCCAAAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017840.2-1007s1c1
Sequence:CCGGGAAGGATTCTGCATTTCTATTCTCGAGAATAGAAATGCAGAATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017840.2-974s1c1
Sequence:CCGGGTGTAGGAGATAACTGTATATCTCGAGATATACAGTTATCTCCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017840.3-1035s21c1
Sequence:CCGGGCCTACCCACTGAAGTCTTTGCTCGAGCAAAGACTTCAGTGGGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017840.3-741s21c1
Sequence:CCGGTTGACCAGGTTGCCCACAAGTCTCGAGACTTGTGGGCAACCTGGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017840.3-533s21c1
Sequence:CCGGCTGACAATCAACCGCTCTATGCTCGAGCATAGAGCGGTTGATTGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017840.3-820s21c1
Sequence:CCGGAGAGGAAAGAGAACGTAACAACTCGAGTTGTTACGTTCTCTTTCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017840
VALIDATED
MRPL16 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L16
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-302s1c1
Sequence:CCGGGTAAAGACACTGCTCCCAGTACTCGAGTACTGGGAGCAGTGTCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-332s1c1
Sequence:CCGGGAAGATGTTTCCATTCCTGAACTCGAGTTCAGGAATGGAAACATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-446s1c1
Sequence:CCGGGAAGCTACGGAGTTTACAGAACTCGAGTTCTGTAAACTCCGTAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-1001s1c1
Sequence:CCGGCTGAAAGAAGGATTCTGCATTCTCGAGAATGCAGAATCCTTCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017840.2-1046s1c1
Sequence:CCGGGAAGTCTTTGGGTAGCTCTTACTCGAGTAAGAGCTACCCAAAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017840.2-1007s1c1
Sequence:CCGGGAAGGATTCTGCATTTCTATTCTCGAGAATAGAAATGCAGAATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017840.2-974s1c1
Sequence:CCGGGTGTAGGAGATAACTGTATATCTCGAGATATACAGTTATCTCCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017840.3-1035s21c1
Sequence:CCGGGCCTACCCACTGAAGTCTTTGCTCGAGCAAAGACTTCAGTGGGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017840.3-741s21c1
Sequence:CCGGTTGACCAGGTTGCCCACAAGTCTCGAGACTTGTGGGCAACCTGGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017840.3-533s21c1
Sequence:CCGGCTGACAATCAACCGCTCTATGCTCGAGCATAGAGCGGTTGATTGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017840.3-820s21c1
Sequence:CCGGAGAGGAAAGAGAACGTAACAACTCGAGTTGTTACGTTCTCTTTCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017840
VALIDATED
MRPL16 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L16
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-302s1c1
Sequence:CCGGGTAAAGACACTGCTCCCAGTACTCGAGTACTGGGAGCAGTGTCTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-332s1c1
Sequence:CCGGGAAGATGTTTCCATTCCTGAACTCGAGTTCAGGAATGGAAACATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-446s1c1
Sequence:CCGGGAAGCTACGGAGTTTACAGAACTCGAGTTCTGTAAACTCCGTAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_017840.2-1001s1c1
Sequence:CCGGCTGAAAGAAGGATTCTGCATTCTCGAGAATGCAGAATCCTTCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017840.2-1046s1c1
Sequence:CCGGGAAGTCTTTGGGTAGCTCTTACTCGAGTAAGAGCTACCCAAAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017840.2-1007s1c1
Sequence:CCGGGAAGGATTCTGCATTTCTATTCTCGAGAATAGAAATGCAGAATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017840.2-974s1c1
Sequence:CCGGGTGTAGGAGATAACTGTATATCTCGAGATATACAGTTATCTCCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017840.3-1035s21c1
Sequence:CCGGGCCTACCCACTGAAGTCTTTGCTCGAGCAAAGACTTCAGTGGGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017840.3-741s21c1
Sequence:CCGGTTGACCAGGTTGCCCACAAGTCTCGAGACTTGTGGGCAACCTGGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017840.3-533s21c1
Sequence:CCGGCTGACAATCAACCGCTCTATGCTCGAGCATAGAGCGGTTGATTGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017840.3-820s21c1
Sequence:CCGGAGAGGAAAGAGAACGTAACAACTCGAGTTGTTACGTTCTCTTTCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)