EMAIL THIS PAGE TO A FRIEND

MRPL17

mitochondrial ribosomal protein L17

100 Gene Product Result for
Synonyms: L17mt LIP2 MRP-L17 MRP-L26 RPL17L RPML26
UniProtKB ID: Q9NRX2, D3DQU3, Q6IAH8, Q96Q53, Q9C066
Gene ID:
Human(63875) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(27397) mitochondrial ribosomal protein L17
Rat(171061) mitochondrial ribosomal protein L17
sheep(101116599) mitochondrial ribosomal protein L17
domestic guinea pig(100733388) mitochondrial ribosomal protein L17
naked mole-rat(101708162) mitochondrial ribosomal protein L17
Zebrafish(447945) mitochondrial ribosomal protein L17
domestic cat(101093800) mitochondrial ribosomal protein L17
cow(506988) mitochondrial ribosomal protein L17
dog(610200) mitochondrial ribosomal protein L17
fruit fly(38046) mitochondrial ribosomal protein L17
chicken(769700) mitochondrial ribosomal protein L17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022061 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022061 Rosetta Predictions human pricing
NM_133539 Rosetta Predictions rat pricing
NM_025301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085243 predicted 514
2 SASI_Hs02_00355419 predicted 1049
3 SASI_Hs02_00355420 predicted 1056
4 SASI_Hs02_00355421 predicted 1103
5 SASI_Hs01_00085244 predicted 454
6 SASI_Hs01_00085246 predicted 420
7 SASI_Hs01_00085247 predicted 467
8 SASI_Hs01_00085248 predicted 337
9 SASI_Hs02_00355422 predicted 1047
10 SASI_Hs01_00085252 predicted 352
11 SASI_Hs01_00085245 predicted 295
12 SASI_Hs01_00085249 predicted 300
13 SASI_Hs01_00085250 predicted 409
14 SASI_Hs01_00085251 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049876 predicted 750
2 SASI_Rn01_00049877 predicted 485
3 SASI_Rn01_00049878 predicted 643
4 SASI_Rn01_00049879 predicted 304
5 SASI_Rn02_00267726 predicted 493
6 SASI_Rn01_00049881 predicted 554
7 SASI_Rn01_00049882 predicted 783
8 SASI_Rn01_00049883 predicted 405
9 SASI_Rn01_00049884 predicted 738
10 SASI_Rn01_00049885 predicted 230
11 SASI_Rn01_00049880 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327921 predicted 766
2 SASI_Mm02_00327922 predicted 472
3 SASI_Mm02_00327923 predicted 955
4 SASI_Mm02_00327924 predicted 608
5 SASI_Mm02_00327925 predicted 1062
6 SASI_Mm02_00327926 predicted 603
7 SASI_Mm02_00327927 predicted 965
8 SASI_Mm02_00327928 predicted 767
9 SASI_Mm02_00327929 predicted 831
10 SASI_Mm02_00327930 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022061
VALIDATED
MRPL17 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L17
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-429s21c1
Sequence:CCGGGCAGATCCCAAATCGGAGTTTCTCGAGAAACTCCGATTTGGGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-289s1c1
Sequence:CCGGCAGAGAAGGATTTGATCCCAACTCGAGTTGGGATCAAATCCTTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022061.2-305s1c1
Sequence:CCGGCCCAAAGCTGTTTCAAGTACTCTCGAGAGTACTTGAAACAGCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-597s1c1
Sequence:CCGGCCCTTAATCAGTACCCATGATCTCGAGATCATGGGTACTGATTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022061.2-356s1c1
Sequence:CCGGCTACACAAGAATGCTGCAGATCTCGAGATCTGCAGCATTCTTGTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-330s1c1
Sequence:CCGGCCTCGGTACAAAGATCAAACTCTCGAGAGTTTGATCTTTGTACCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022061.2-218s1c1
Sequence:CCGGGAAGCTCATCGACTATGGGAACTCGAGTTCCCATAGTCGATGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-371s1c1
Sequence:CCGGGCAGATCCCAAATCGGAGTTTCTCGAGAAACTCCGATTTGGGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-388s21c1
Sequence:CCGGCCTCGGTACAAAGATCAAACTCTCGAGAGTTTGATCTTTGTACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-347s21c1
Sequence:CCGGCAGAGAAGGATTTGATCCCAACTCGAGTTGGGATCAAATCCTTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-655s21c1
Sequence:CCGGCCCTTAATCAGTACCCATGATCTCGAGATCATGGGTACTGATTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022061
VALIDATED
MRPL17 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L17
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-429s21c1
Sequence:CCGGGCAGATCCCAAATCGGAGTTTCTCGAGAAACTCCGATTTGGGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-289s1c1
Sequence:CCGGCAGAGAAGGATTTGATCCCAACTCGAGTTGGGATCAAATCCTTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022061.2-305s1c1
Sequence:CCGGCCCAAAGCTGTTTCAAGTACTCTCGAGAGTACTTGAAACAGCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-597s1c1
Sequence:CCGGCCCTTAATCAGTACCCATGATCTCGAGATCATGGGTACTGATTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022061.2-356s1c1
Sequence:CCGGCTACACAAGAATGCTGCAGATCTCGAGATCTGCAGCATTCTTGTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-330s1c1
Sequence:CCGGCCTCGGTACAAAGATCAAACTCTCGAGAGTTTGATCTTTGTACCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022061.2-218s1c1
Sequence:CCGGGAAGCTCATCGACTATGGGAACTCGAGTTCCCATAGTCGATGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-371s1c1
Sequence:CCGGGCAGATCCCAAATCGGAGTTTCTCGAGAAACTCCGATTTGGGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-388s21c1
Sequence:CCGGCCTCGGTACAAAGATCAAACTCTCGAGAGTTTGATCTTTGTACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-347s21c1
Sequence:CCGGCAGAGAAGGATTTGATCCCAACTCGAGTTGGGATCAAATCCTTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-655s21c1
Sequence:CCGGCCCTTAATCAGTACCCATGATCTCGAGATCATGGGTACTGATTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022061
VALIDATED
MRPL17 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L17
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-429s21c1
Sequence:CCGGGCAGATCCCAAATCGGAGTTTCTCGAGAAACTCCGATTTGGGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-289s1c1
Sequence:CCGGCAGAGAAGGATTTGATCCCAACTCGAGTTGGGATCAAATCCTTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022061.2-305s1c1
Sequence:CCGGCCCAAAGCTGTTTCAAGTACTCTCGAGAGTACTTGAAACAGCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-597s1c1
Sequence:CCGGCCCTTAATCAGTACCCATGATCTCGAGATCATGGGTACTGATTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022061.2-356s1c1
Sequence:CCGGCTACACAAGAATGCTGCAGATCTCGAGATCTGCAGCATTCTTGTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-330s1c1
Sequence:CCGGCCTCGGTACAAAGATCAAACTCTCGAGAGTTTGATCTTTGTACCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022061.2-218s1c1
Sequence:CCGGGAAGCTCATCGACTATGGGAACTCGAGTTCCCATAGTCGATGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022061.2-371s1c1
Sequence:CCGGGCAGATCCCAAATCGGAGTTTCTCGAGAAACTCCGATTTGGGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-388s21c1
Sequence:CCGGCCTCGGTACAAAGATCAAACTCTCGAGAGTTTGATCTTTGTACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-347s21c1
Sequence:CCGGCAGAGAAGGATTTGATCCCAACTCGAGTTGGGATCAAATCCTTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022061.3-655s21c1
Sequence:CCGGCCCTTAATCAGTACCCATGATCTCGAGATCATGGGTACTGATTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025301
VALIDATED
MRPL17 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L17
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-617s21c1
Sequence:CCGGGTTCAAACACCAAAGACTTAACTCGAGTTAAGTCTTTGGTGTTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025301.2-4999s1c1
Sequence:CCGGCAAGTGAAGCTCAGCGTTATTCTCGAGAATAACGCTGAGCTTCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.1-447s1c1
Sequence:CCGGGATGGCGGTGATAGAATATAACTCGAGTTATATTCTATCACCGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.1-346s1c1
Sequence:CCGGCCAAAGCTGTTTAAAGTGCTACTCGAGTAGCACTTTAAACAGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.1-507s1c1
Sequence:CCGGCAGCAACCTTACTCTCCTAAACTCGAGTTTAGGAGAGTAAGGTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-467s21c1
Sequence:CCGGATGGCGGTGATAGAATATAAACTCGAGTTTATATTCTATCACCGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-359s21c1
Sequence:CCGGTTGATCCCAAAGCTGTTTAAACTCGAGTTTAAACAGCTTTGGGATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.2-617s1c1
Sequence:CCGGGTTCAAACACCAAAGACTTAACTCGAGTTAAGTCTTTGGTGTTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-272s21c1
Sequence:CCGGGCGGAGAAGCTCATCGATTATCTCGAGATAATCGATGAGCTTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025301.2-2889s21c1
Sequence:CCGGTGAGTAGACATTGCCTAAATACTCGAGTATTTAGGCAATGTCTACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025301
VALIDATED
MRPL17 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L17
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-617s21c1
Sequence:CCGGGTTCAAACACCAAAGACTTAACTCGAGTTAAGTCTTTGGTGTTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025301.2-4999s1c1
Sequence:CCGGCAAGTGAAGCTCAGCGTTATTCTCGAGAATAACGCTGAGCTTCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.1-447s1c1
Sequence:CCGGGATGGCGGTGATAGAATATAACTCGAGTTATATTCTATCACCGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.1-346s1c1
Sequence:CCGGCCAAAGCTGTTTAAAGTGCTACTCGAGTAGCACTTTAAACAGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.1-507s1c1
Sequence:CCGGCAGCAACCTTACTCTCCTAAACTCGAGTTTAGGAGAGTAAGGTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-467s21c1
Sequence:CCGGATGGCGGTGATAGAATATAAACTCGAGTTTATATTCTATCACCGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-359s21c1
Sequence:CCGGTTGATCCCAAAGCTGTTTAAACTCGAGTTTAAACAGCTTTGGGATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.2-617s1c1
Sequence:CCGGGTTCAAACACCAAAGACTTAACTCGAGTTAAGTCTTTGGTGTTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-272s21c1
Sequence:CCGGGCGGAGAAGCTCATCGATTATCTCGAGATAATCGATGAGCTTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025301.2-2889s21c1
Sequence:CCGGTGAGTAGACATTGCCTAAATACTCGAGTATTTAGGCAATGTCTACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025301
VALIDATED
MRPL17 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L17
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-617s21c1
Sequence:CCGGGTTCAAACACCAAAGACTTAACTCGAGTTAAGTCTTTGGTGTTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025301.2-4999s1c1
Sequence:CCGGCAAGTGAAGCTCAGCGTTATTCTCGAGAATAACGCTGAGCTTCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.1-447s1c1
Sequence:CCGGGATGGCGGTGATAGAATATAACTCGAGTTATATTCTATCACCGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.1-346s1c1
Sequence:CCGGCCAAAGCTGTTTAAAGTGCTACTCGAGTAGCACTTTAAACAGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.1-507s1c1
Sequence:CCGGCAGCAACCTTACTCTCCTAAACTCGAGTTTAGGAGAGTAAGGTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-467s21c1
Sequence:CCGGATGGCGGTGATAGAATATAAACTCGAGTTTATATTCTATCACCGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-359s21c1
Sequence:CCGGTTGATCCCAAAGCTGTTTAAACTCGAGTTTAAACAGCTTTGGGATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025301.2-617s1c1
Sequence:CCGGGTTCAAACACCAAAGACTTAACTCGAGTTAAGTCTTTGGTGTTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025301.2-272s21c1
Sequence:CCGGGCGGAGAAGCTCATCGATTATCTCGAGATAATCGATGAGCTTCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025301.2-2889s21c1
Sequence:CCGGTGAGTAGACATTGCCTAAATACTCGAGTATTTAGGCAATGTCTACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)