EMAIL THIS PAGE TO A FRIEND

MRPL18

mitochondrial ribosomal protein L18

49 Gene Product Result for
Synonyms: L18mt MRP-L18
UniProtKB ID: Q9H0U6, Q5TAP9, Q9NZW8
Gene ID:
Human(29074) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L18P ribosomal protein family. Three polymorphic sites exist in this gene, one of which is three nt in length which causes an extra aa near the N-terminus. [provided by RefSeq, Jul 2008]
Mouse(67681) mitochondrial ribosomal protein L18
Rat(292244) mitochondrial ribosomal protein L18
fruit fly(36406) mitochondrial ribosomal protein L18
cow(534352) mitochondrial ribosomal protein L18
domestic cat(101094105) mitochondrial ribosomal protein L18
dog(476260) mitochondrial ribosomal protein L18
chicken(421585) mitochondrial ribosomal protein L18
naked mole-rat(101710202) mitochondrial ribosomal protein L18
domestic guinea pig(100713544) mitochondrial ribosomal protein L18
sheep(101111291) mitochondrial ribosomal protein L18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014161 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014161 Rosetta Predictions human pricing
NM_001106205 Rosetta Predictions rat pricing
NM_026310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201551 predicted 330
2 SASI_Hs01_00201552 predicted 338
3 SASI_Hs01_00201553 predicted 420
4 SASI_Hs01_00201554 predicted 387
5 SASI_Hs01_00201555 predicted 403
6 SASI_Hs01_00201556 predicted 650
7 SASI_Hs01_00201557 predicted 591
8 SASI_Hs01_00201558 predicted 469
9 SASI_Hs01_00201559 predicted 584
10 SASI_Hs01_00201560 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216668 predicted 387
2 SASI_Rn02_00216669 predicted 349
3 SASI_Rn02_00216670 predicted 261
4 SASI_Rn02_00216671 predicted 245
5 SASI_Rn02_00216672 predicted 335
6 SASI_Rn02_00216673 predicted 448
7 SASI_Rn02_00216674 predicted 379
8 SASI_Rn02_00216675 predicted 399
9 SASI_Rn02_00216676 predicted 431
10 SASI_Rn02_00216677 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064451 predicted 286
2 SASI_Mm01_00064452 predicted 453
3 SASI_Mm01_00064453 predicted 241
4 SASI_Mm01_00064454 predicted 241
5 SASI_Mm01_00064455 predicted 378
6 SASI_Mm01_00064456 predicted 405
7 SASI_Mm01_00064457 predicted 326
8 SASI_Mm01_00064458 predicted 338
9 SASI_Mm01_00064459 predicted 220
10 SASI_Mm01_00064460 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026310
VALIDATED
MRPL18 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L18
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-337s1c1
Sequence:CCGGGCGAGTTGTAAAGACTCAGCACTCGAGTGCTGAGTCTTTACAACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-677s1c1
Sequence:CCGGCTACCATCTACAGCCACCAAACTCGAGTTTGGTGGCTGTAGATGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026310.1-614s1c1
Sequence:CCGGGAGCCTCGAAGAATCTATGAACTCGAGTTCATAGATTCTTCGAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-693s1c1
Sequence:CCGGCCAAAGGAAAGCATCTGCATTCTCGAGAATGCAGATGCTTTCCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-788s1c1
Sequence:CCGGCAGAGCAATAATGTGACTGAACTCGAGTTCAGTCACATTATTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026310.3-692s21c1
Sequence:CCGGCCAAAGGAAAGCATCTGCATTCTCGAGAATGCAGATGCTTTCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026310.3-613s21c1
Sequence:CCGGGAGCCTCGAAGAATCTATGAACTCGAGTTCATAGATTCTTCGAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026310.3-676s21c1
Sequence:CCGGCTACCATCTACAGCCACCAAACTCGAGTTTGGTGGCTGTAGATGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026310.3-787s21c1
Sequence:CCGGCAGAGCAATAATGTGACTGAACTCGAGTTCAGTCACATTATTGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026310.3-336s21c1
Sequence:CCGGGCGAGTTGTAAAGACTCAGCACTCGAGTGCTGAGTCTTTACAACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026310
VALIDATED
MRPL18 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L18
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-337s1c1
Sequence:CCGGGCGAGTTGTAAAGACTCAGCACTCGAGTGCTGAGTCTTTACAACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-677s1c1
Sequence:CCGGCTACCATCTACAGCCACCAAACTCGAGTTTGGTGGCTGTAGATGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026310.1-614s1c1
Sequence:CCGGGAGCCTCGAAGAATCTATGAACTCGAGTTCATAGATTCTTCGAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-693s1c1
Sequence:CCGGCCAAAGGAAAGCATCTGCATTCTCGAGAATGCAGATGCTTTCCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-788s1c1
Sequence:CCGGCAGAGCAATAATGTGACTGAACTCGAGTTCAGTCACATTATTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026310.3-692s21c1
Sequence:CCGGCCAAAGGAAAGCATCTGCATTCTCGAGAATGCAGATGCTTTCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026310.3-613s21c1
Sequence:CCGGGAGCCTCGAAGAATCTATGAACTCGAGTTCATAGATTCTTCGAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026310.3-676s21c1
Sequence:CCGGCTACCATCTACAGCCACCAAACTCGAGTTTGGTGGCTGTAGATGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026310.3-787s21c1
Sequence:CCGGCAGAGCAATAATGTGACTGAACTCGAGTTCAGTCACATTATTGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026310.3-336s21c1
Sequence:CCGGGCGAGTTGTAAAGACTCAGCACTCGAGTGCTGAGTCTTTACAACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026310
VALIDATED
MRPL18 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L18
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-337s1c1
Sequence:CCGGGCGAGTTGTAAAGACTCAGCACTCGAGTGCTGAGTCTTTACAACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-677s1c1
Sequence:CCGGCTACCATCTACAGCCACCAAACTCGAGTTTGGTGGCTGTAGATGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026310.1-614s1c1
Sequence:CCGGGAGCCTCGAAGAATCTATGAACTCGAGTTCATAGATTCTTCGAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-693s1c1
Sequence:CCGGCCAAAGGAAAGCATCTGCATTCTCGAGAATGCAGATGCTTTCCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026310.1-788s1c1
Sequence:CCGGCAGAGCAATAATGTGACTGAACTCGAGTTCAGTCACATTATTGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026310.3-692s21c1
Sequence:CCGGCCAAAGGAAAGCATCTGCATTCTCGAGAATGCAGATGCTTTCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026310.3-613s21c1
Sequence:CCGGGAGCCTCGAAGAATCTATGAACTCGAGTTCATAGATTCTTCGAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026310.3-676s21c1
Sequence:CCGGCTACCATCTACAGCCACCAAACTCGAGTTTGGTGGCTGTAGATGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026310.3-787s21c1
Sequence:CCGGCAGAGCAATAATGTGACTGAACTCGAGTTCAGTCACATTATTGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026310.3-336s21c1
Sequence:CCGGGCGAGTTGTAAAGACTCAGCACTCGAGTGCTGAGTCTTTACAACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014161
VALIDATED
MRPL18 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L18
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-405s1c1
Sequence:CCGGGAGCATCAGAATGGCAAGGTTCTCGAGAACCTTGCCATTCTGATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014161.2-365s1c1
Sequence:CCGGGCGAGTTATAAGGACTCAGCACTCGAGTGCTGAGTCCTTATAACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014161.2-396s1c1
Sequence:CCGGGCACTTGTGGAGCATCAGAATCTCGAGATTCTGATGCTCCACAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-492s1c1
Sequence:CCGGGCTTGTGAGAGTATAGGACGACTCGAGTCGTCCTATACTCTCACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014161.2-366s1c1
Sequence:CCGGCGAGTTATAAGGACTCAGCATCTCGAGATGCTGAGTCCTTATAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-768s1c1
Sequence:CCGGGCAATAATGTTGCAGTGGAATCTCGAGATTCCACTGCAACATTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-596s1c1
Sequence:CCGGGAAACGACTACAAAGTGCCATCTCGAGATGGCACTTTGTAGTCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014161.2-383s1c1
Sequence:CCGGGCATCATGTAGAAGCACTTGTCTCGAGACAAGTGCTTCTACATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-652s21c1
Sequence:CCGGCTCAGAGAATCTATGAATAAACTCGAGTTTATTCATAGATTCTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-774s21c1
Sequence:CCGGGCAATAATGTTGCAGTGGAATCTCGAGATTCCACTGCAACATTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-498s21c1
Sequence:CCGGGCTTGTGAGAGTATAGGACGACTCGAGTCGTCCTATACTCTCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-447s21c1
Sequence:CCGGACTCGTGAGTGGGCTATTAAACTCGAGTTTAATAGCCCACTCACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-411s21c1
Sequence:CCGGGAGCATCAGAATGGCAAGGTTCTCGAGAACCTTGCCATTCTGATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014161
VALIDATED
MRPL18 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L18
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-405s1c1
Sequence:CCGGGAGCATCAGAATGGCAAGGTTCTCGAGAACCTTGCCATTCTGATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014161.2-365s1c1
Sequence:CCGGGCGAGTTATAAGGACTCAGCACTCGAGTGCTGAGTCCTTATAACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014161.2-396s1c1
Sequence:CCGGGCACTTGTGGAGCATCAGAATCTCGAGATTCTGATGCTCCACAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-492s1c1
Sequence:CCGGGCTTGTGAGAGTATAGGACGACTCGAGTCGTCCTATACTCTCACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014161.2-366s1c1
Sequence:CCGGCGAGTTATAAGGACTCAGCATCTCGAGATGCTGAGTCCTTATAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-768s1c1
Sequence:CCGGGCAATAATGTTGCAGTGGAATCTCGAGATTCCACTGCAACATTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-596s1c1
Sequence:CCGGGAAACGACTACAAAGTGCCATCTCGAGATGGCACTTTGTAGTCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014161.2-383s1c1
Sequence:CCGGGCATCATGTAGAAGCACTTGTCTCGAGACAAGTGCTTCTACATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-652s21c1
Sequence:CCGGCTCAGAGAATCTATGAATAAACTCGAGTTTATTCATAGATTCTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-774s21c1
Sequence:CCGGGCAATAATGTTGCAGTGGAATCTCGAGATTCCACTGCAACATTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-498s21c1
Sequence:CCGGGCTTGTGAGAGTATAGGACGACTCGAGTCGTCCTATACTCTCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-447s21c1
Sequence:CCGGACTCGTGAGTGGGCTATTAAACTCGAGTTTAATAGCCCACTCACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-411s21c1
Sequence:CCGGGAGCATCAGAATGGCAAGGTTCTCGAGAACCTTGCCATTCTGATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014161
VALIDATED
MRPL18 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L18
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-405s1c1
Sequence:CCGGGAGCATCAGAATGGCAAGGTTCTCGAGAACCTTGCCATTCTGATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014161.2-365s1c1
Sequence:CCGGGCGAGTTATAAGGACTCAGCACTCGAGTGCTGAGTCCTTATAACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014161.2-396s1c1
Sequence:CCGGGCACTTGTGGAGCATCAGAATCTCGAGATTCTGATGCTCCACAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-492s1c1
Sequence:CCGGGCTTGTGAGAGTATAGGACGACTCGAGTCGTCCTATACTCTCACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014161.2-366s1c1
Sequence:CCGGCGAGTTATAAGGACTCAGCATCTCGAGATGCTGAGTCCTTATAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-768s1c1
Sequence:CCGGGCAATAATGTTGCAGTGGAATCTCGAGATTCCACTGCAACATTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014161.2-596s1c1
Sequence:CCGGGAAACGACTACAAAGTGCCATCTCGAGATGGCACTTTGTAGTCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014161.2-383s1c1
Sequence:CCGGGCATCATGTAGAAGCACTTGTCTCGAGACAAGTGCTTCTACATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-652s21c1
Sequence:CCGGCTCAGAGAATCTATGAATAAACTCGAGTTTATTCATAGATTCTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-774s21c1
Sequence:CCGGGCAATAATGTTGCAGTGGAATCTCGAGATTCCACTGCAACATTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-498s21c1
Sequence:CCGGGCTTGTGAGAGTATAGGACGACTCGAGTCGTCCTATACTCTCACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-447s21c1
Sequence:CCGGACTCGTGAGTGGGCTATTAAACTCGAGTTTAATAGCCCACTCACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014161.3-411s21c1
Sequence:CCGGGAGCATCAGAATGGCAAGGTTCTCGAGAACCTTGCCATTCTGATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)