EMAIL THIS PAGE TO A FRIEND

MRPL19

mitochondrial ribosomal protein L19

120 Gene Product Result for
Synonyms: L19mt MRP-L15 MRP-L19 MRPL15 RLX1 RPML15
UniProtKB ID: P49406, Q53TX9, Q96Q52
Gene ID:
Human(9801) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(56284) mitochondrial ribosomal protein L19
Rat(297372) mitochondrial ribosomal protein L19
sheep(101117575) mitochondrial ribosomal protein L19
domestic guinea pig(100732377) mitochondrial ribosomal protein L19
naked mole-rat(101718877) mitochondrial ribosomal protein L19
Zebrafish(445150) mitochondrial ribosomal protein L19
cow(510957) mitochondrial ribosomal protein L19
domestic cat(101090510) mitochondrial ribosomal protein L19
dog(475780) mitochondrial ribosomal protein L19
chicken(422066) mitochondrial ribosomal protein L19
fruit fly(41028) mitochondrial ribosomal protein L19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014763 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014763 Rosetta Predictions human pricing
NM_001029898 Rosetta Predictions rat pricing
NM_026490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100932 predicted 459
2 SASI_Hs01_00100933 predicted 533
3 SASI_Hs01_00100934 predicted 964
4 SASI_Hs01_00100935 predicted 997
5 SASI_Hs01_00100936 predicted 535
6 SASI_Hs01_00100937 predicted 568
7 SASI_Hs01_00100938 predicted 474
8 SASI_Hs01_00100939 predicted 276
9 SASI_Hs01_00100940 predicted 358
10 SASI_Hs01_00100941 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203459 predicted 481
2 SASI_Rn01_00040529 predicted 721
3 SASI_Rn01_00040530 predicted 324
4 SASI_Rn02_00203460 predicted 253
5 SASI_Rn01_00040531 predicted 716
6 SASI_Rn01_00040532 predicted 477
7 SASI_Rn02_00203461 predicted 850
8 SASI_Rn01_00040533 predicted 215
9 SASI_Rn01_00040534 predicted 256
10 SASI_Rn01_00040535 predicted 806
11 SASI_Rn01_00040536 predicted 749
12 SASI_Rn01_00040537 predicted 295
13 SASI_Rn01_00040538 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330363 predicted 660
2 SASI_Mm02_00330364 predicted 802
3 SASI_Mm02_00330365 predicted 613
4 SASI_Mm02_00330366 predicted 806
5 SASI_Mm02_00330367 predicted 271
6 SASI_Mm02_00330368 predicted 500
7 SASI_Mm02_00330369 predicted 874
8 SASI_Mm02_00330370 predicted 670
9 SASI_Mm02_00330371 predicted 347
10 SASI_Mm02_00330372 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026490
VALIDATED
MRPL19 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L19
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-857s21c1
Sequence:CCGGGAAGCTGCATTGTGGGAAGAACTCGAGTTCTTCCCACAATGCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-808s21c1
Sequence:CCGGGCCATGGATTGAGTTTGATATCTCGAGATATCAAACTCAATCCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-573s21c1
Sequence:CCGGATGACAACCTGCTGTACTTACCTCGAGGTAAGTACAGCAGGTTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-1041s21c1
Sequence:CCGGTGCGTATGTGTACTGCAATTACTCGAGTAATTGCAGTACACATACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-668s21c1
Sequence:CCGGCCTGTTAACAAGCTGAAAGTTCTCGAGAACTTTCAGCTTGTTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026490.2-808s1c1
Sequence:CCGGGCCATGGATTGAGTTTGATATCTCGAGATATCAAACTCAATCCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026490.2-3811s1c1
Sequence:CCGGGCACACATATACACATGCTTTCTCGAGAAAGCATGTGTATATGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026490.2-350s1c1
Sequence:CCGGGAGTTCTATGTTGGAAGCATACTCGAGTATGCTTCCAACATAGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026490.2-857s1c1
Sequence:CCGGGAAGCTGCATTGTGGGAAGAACTCGAGTTCTTCCCACAATGCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026490.2-668s1c1
Sequence:CCGGCCTGTTAACAAGCTGAAAGTTCTCGAGAACTTTCAGCTTGTTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026490
VALIDATED
MRPL19 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L19
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-857s21c1
Sequence:CCGGGAAGCTGCATTGTGGGAAGAACTCGAGTTCTTCCCACAATGCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-808s21c1
Sequence:CCGGGCCATGGATTGAGTTTGATATCTCGAGATATCAAACTCAATCCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-573s21c1
Sequence:CCGGATGACAACCTGCTGTACTTACCTCGAGGTAAGTACAGCAGGTTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-1041s21c1
Sequence:CCGGTGCGTATGTGTACTGCAATTACTCGAGTAATTGCAGTACACATACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-668s21c1
Sequence:CCGGCCTGTTAACAAGCTGAAAGTTCTCGAGAACTTTCAGCTTGTTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026490.2-808s1c1
Sequence:CCGGGCCATGGATTGAGTTTGATATCTCGAGATATCAAACTCAATCCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026490.2-3811s1c1
Sequence:CCGGGCACACATATACACATGCTTTCTCGAGAAAGCATGTGTATATGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026490.2-350s1c1
Sequence:CCGGGAGTTCTATGTTGGAAGCATACTCGAGTATGCTTCCAACATAGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026490.2-857s1c1
Sequence:CCGGGAAGCTGCATTGTGGGAAGAACTCGAGTTCTTCCCACAATGCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026490.2-668s1c1
Sequence:CCGGCCTGTTAACAAGCTGAAAGTTCTCGAGAACTTTCAGCTTGTTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026490
VALIDATED
MRPL19 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L19
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-857s21c1
Sequence:CCGGGAAGCTGCATTGTGGGAAGAACTCGAGTTCTTCCCACAATGCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-808s21c1
Sequence:CCGGGCCATGGATTGAGTTTGATATCTCGAGATATCAAACTCAATCCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-573s21c1
Sequence:CCGGATGACAACCTGCTGTACTTACCTCGAGGTAAGTACAGCAGGTTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-1041s21c1
Sequence:CCGGTGCGTATGTGTACTGCAATTACTCGAGTAATTGCAGTACACATACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026490.2-668s21c1
Sequence:CCGGCCTGTTAACAAGCTGAAAGTTCTCGAGAACTTTCAGCTTGTTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026490.2-808s1c1
Sequence:CCGGGCCATGGATTGAGTTTGATATCTCGAGATATCAAACTCAATCCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026490.2-3811s1c1
Sequence:CCGGGCACACATATACACATGCTTTCTCGAGAAAGCATGTGTATATGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026490.2-350s1c1
Sequence:CCGGGAGTTCTATGTTGGAAGCATACTCGAGTATGCTTCCAACATAGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026490.2-857s1c1
Sequence:CCGGGAAGCTGCATTGTGGGAAGAACTCGAGTTCTTCCCACAATGCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026490.2-668s1c1
Sequence:CCGGCCTGTTAACAAGCTGAAAGTTCTCGAGAACTTTCAGCTTGTTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014763
VALIDATED
MRPL19 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-568s1c1
Sequence:CCGGGCTGGATGATAGCTTGCTATACTCGAGTATAGCAAGCTATCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-240s1c1
Sequence:CCGGGCAGGTTCTTGAGTCCTGAATCTCGAGATTCAGGACTCAAGAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-863s1c1
Sequence:CCGGGCAATATGGAAGGAAATTGAACTCGAGTTCAATTTCCTTCCATATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-502s1c1
Sequence:CCGGCGAGATTTGCTTTGAACTTTACTCGAGTAAAGTTCAAAGCAAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-637s1c1
Sequence:CCGGGCCAGTAGTACAAGAGCCTAACTCGAGTTAGGCTCTTGTACTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014763
VALIDATED
MRPL19 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-568s1c1
Sequence:CCGGGCTGGATGATAGCTTGCTATACTCGAGTATAGCAAGCTATCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-240s1c1
Sequence:CCGGGCAGGTTCTTGAGTCCTGAATCTCGAGATTCAGGACTCAAGAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-863s1c1
Sequence:CCGGGCAATATGGAAGGAAATTGAACTCGAGTTCAATTTCCTTCCATATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-502s1c1
Sequence:CCGGCGAGATTTGCTTTGAACTTTACTCGAGTAAAGTTCAAAGCAAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-637s1c1
Sequence:CCGGGCCAGTAGTACAAGAGCCTAACTCGAGTTAGGCTCTTGTACTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014763
VALIDATED
MRPL19 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-568s1c1
Sequence:CCGGGCTGGATGATAGCTTGCTATACTCGAGTATAGCAAGCTATCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-240s1c1
Sequence:CCGGGCAGGTTCTTGAGTCCTGAATCTCGAGATTCAGGACTCAAGAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-863s1c1
Sequence:CCGGGCAATATGGAAGGAAATTGAACTCGAGTTCAATTTCCTTCCATATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-502s1c1
Sequence:CCGGCGAGATTTGCTTTGAACTTTACTCGAGTAAAGTTCAAAGCAAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014763.2-637s1c1
Sequence:CCGGGCCAGTAGTACAAGAGCCTAACTCGAGTTAGGCTCTTGTACTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)