EMAIL THIS PAGE TO A FRIEND

MRPL21

mitochondrial ribosomal protein L21

62 Gene Product Result for
Synonyms: L21mt MRP-L21
UniProtKB ID: Q7Z2W9, A6NKU0, C9JPR2
Gene ID:
Human(219927) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding different isoforms were identified through sequence analysis although some may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
Mouse(353242) mitochondrial ribosomal protein L21
Rat(309140) mitochondrial ribosomal protein L21
Zebrafish(768305) mitochondrial ribosomal protein L21
cow(618609) mitochondrial ribosomal protein L21
domestic cat(101085575) mitochondrial ribosomal protein L21
dog(476000) mitochondrial ribosomal protein L21
chicken(423000) mitochondrial ribosomal protein L21
fruit fly(40091) mitochondrial ribosomal protein L21
naked mole-rat(101714401) mitochondrial ribosomal protein L21
domestic guinea pig(100715028) mitochondrial ribosomal protein L21
sheep(101114736) mitochondrial ribosomal protein L21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181512 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152251 MISSION® esiRNA esiRNA human MRPL21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181514 Rosetta Predictions human pricing
NM_181515 Rosetta Predictions human pricing
NM_001107567 Rosetta Predictions rat pricing
NM_172252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370137 predicted 463
2 SASI_Hs01_00047095 predicted 467
3 SASI_Hs01_00047096 predicted 454
4 SASI_Hs01_00047097 predicted 452
5 SASI_Hs01_00047098 predicted 467
6 SASI_Hs01_00047099 predicted 467
7 SASI_Hs02_00370138 predicted 380
8 SASI_Hs01_00047100 predicted 468
9 SASI_Hs01_00047101 predicted 469
10 SASI_Hs01_00047102 predicted 438
11 SASI_Hs01_00047103 predicted 392
12 SASI_Hs01_00047104 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370139 predicted 468
2 SASI_Hs01_00111188 predicted 481
3 SASI_Hs01_00111189 predicted 474
4 SASI_Hs01_00111190 predicted 471
5 SASI_Hs01_00111191 predicted 480
6 SASI_Hs01_00111192 predicted 479
7 SASI_Hs02_00370140 predicted 389
8 SASI_Hs01_00111193 predicted 474
9 SASI_Hs01_00111194 predicted 480
10 SASI_Hs01_00111195 predicted 456
11 SASI_Hs01_00111196 predicted 402
12 SASI_Hs01_00111197 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230105 predicted 624
2 SASI_Rn02_00230106 predicted 570
3 SASI_Rn02_00230107 predicted 495
4 SASI_Rn02_00230108 predicted 657
5 SASI_Rn02_00230109 predicted 448
6 SASI_Rn02_00230110 predicted 435
7 SASI_Rn02_00230111 predicted 293
8 SASI_Rn02_00230112 predicted 374
9 SASI_Rn02_00230113 predicted 685
10 SASI_Rn02_00230114 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181297 predicted 249
2 SASI_Mm01_00181298 predicted 314
3 SASI_Mm01_00181299 predicted 248
4 SASI_Mm01_00181301 predicted 239
5 SASI_Mm01_00181302 predicted 291
6 SASI_Mm01_00181303 predicted 204
7 SASI_Mm01_00181304 predicted 314
8 SASI_Mm01_00181305 predicted 317
9 SASI_Mm02_00343718 predicted 228
10 SASI_Mm01_00181306 predicted 253
11 SASI_Mm01_00181300 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172252
MRPL21 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L21
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-486s1c1
Sequence:CCGGCGAAAGGAGCTTGTACGAGTTCTCGAGAACTCGTACAAGCTCCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-656s1c1
Sequence:CCGGGCCTACTTTGCACCTCGTTTACTCGAGTAAACGAGGTGCAAAGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-630s1c1
Sequence:CCGGCAAAGAGAGCAATTCTCAGAACTCGAGTTCTGAGAATTGCTCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-366s1c1
Sequence:CCGGGCAGAGGACCTGATTCTAATTCTCGAGAATTAGAATCAGGTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172252
MRPL21 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L21
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-486s1c1
Sequence:CCGGCGAAAGGAGCTTGTACGAGTTCTCGAGAACTCGTACAAGCTCCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-656s1c1
Sequence:CCGGGCCTACTTTGCACCTCGTTTACTCGAGTAAACGAGGTGCAAAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-630s1c1
Sequence:CCGGCAAAGAGAGCAATTCTCAGAACTCGAGTTCTGAGAATTGCTCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-366s1c1
Sequence:CCGGGCAGAGGACCTGATTCTAATTCTCGAGAATTAGAATCAGGTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172252
MRPL21 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L21
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-486s1c1
Sequence:CCGGCGAAAGGAGCTTGTACGAGTTCTCGAGAACTCGTACAAGCTCCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-656s1c1
Sequence:CCGGGCCTACTTTGCACCTCGTTTACTCGAGTAAACGAGGTGCAAAGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-630s1c1
Sequence:CCGGCAAAGAGAGCAATTCTCAGAACTCGAGTTCTGAGAATTGCTCTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172252.2-366s1c1
Sequence:CCGGGCAGAGGACCTGATTCTAATTCTCGAGAATTAGAATCAGGTCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181512
VALIDATED
MRPL21 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-569s1c1
Sequence:CCGGCGAGTAGAAGCCACAGTCATTCTCGAGAATGACTGTGGCTTCTACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-257s1c1
Sequence:CCGGGAGGTCGTGAAGAAGGTGAATCTCGAGATTCACCTTCTTCACGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181512.1-528s1c1
Sequence:CCGGGACAGTGGTCACAGTGCAATTCTCGAGAATTGCACTGTGACCACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-349s1c1
Sequence:CCGGGACCTCTGAAGACCTGATCTTCTCGAGAAGATCAGGTCTTCAGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181512.1-537s1c1
Sequence:CCGGCACAGTGCAATTAGGCCAGAACTCGAGTTCTGGCCTAATTGCACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-126s1c1
Sequence:CCGGCTGCTTCTCGAAGGTTCAATTCTCGAGAATTGAACCTTCGAGAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-262s1c1
Sequence:CCGGCGTGAAGAAGGTGAATGAGATCTCGAGATCTCATTCACCTTCTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-265s1c1
Sequence:CCGGGAAGAAGGTGAATGAGATGATCTCGAGATCATCTCATTCACCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-375s1c1
Sequence:CCGGGAAATGAACTAGACCTTGCGTCTCGAGACGCAAGGTCTAGTTCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-595s1c1
Sequence:CCGGGACAGAATCATGGCCAAGAATCTCGAGATTCTTGGCCATGATTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181512
VALIDATED
MRPL21 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-569s1c1
Sequence:CCGGCGAGTAGAAGCCACAGTCATTCTCGAGAATGACTGTGGCTTCTACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-257s1c1
Sequence:CCGGGAGGTCGTGAAGAAGGTGAATCTCGAGATTCACCTTCTTCACGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181512.1-528s1c1
Sequence:CCGGGACAGTGGTCACAGTGCAATTCTCGAGAATTGCACTGTGACCACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-349s1c1
Sequence:CCGGGACCTCTGAAGACCTGATCTTCTCGAGAAGATCAGGTCTTCAGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181512.1-537s1c1
Sequence:CCGGCACAGTGCAATTAGGCCAGAACTCGAGTTCTGGCCTAATTGCACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-126s1c1
Sequence:CCGGCTGCTTCTCGAAGGTTCAATTCTCGAGAATTGAACCTTCGAGAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-262s1c1
Sequence:CCGGCGTGAAGAAGGTGAATGAGATCTCGAGATCTCATTCACCTTCTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-265s1c1
Sequence:CCGGGAAGAAGGTGAATGAGATGATCTCGAGATCATCTCATTCACCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-375s1c1
Sequence:CCGGGAAATGAACTAGACCTTGCGTCTCGAGACGCAAGGTCTAGTTCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-595s1c1
Sequence:CCGGGACAGAATCATGGCCAAGAATCTCGAGATTCTTGGCCATGATTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181512
VALIDATED
MRPL21 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-569s1c1
Sequence:CCGGCGAGTAGAAGCCACAGTCATTCTCGAGAATGACTGTGGCTTCTACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-257s1c1
Sequence:CCGGGAGGTCGTGAAGAAGGTGAATCTCGAGATTCACCTTCTTCACGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181512.1-528s1c1
Sequence:CCGGGACAGTGGTCACAGTGCAATTCTCGAGAATTGCACTGTGACCACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-349s1c1
Sequence:CCGGGACCTCTGAAGACCTGATCTTCTCGAGAAGATCAGGTCTTCAGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181512.1-537s1c1
Sequence:CCGGCACAGTGCAATTAGGCCAGAACTCGAGTTCTGGCCTAATTGCACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-126s1c1
Sequence:CCGGCTGCTTCTCGAAGGTTCAATTCTCGAGAATTGAACCTTCGAGAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-262s1c1
Sequence:CCGGCGTGAAGAAGGTGAATGAGATCTCGAGATCTCATTCACCTTCTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-265s1c1
Sequence:CCGGGAAGAAGGTGAATGAGATGATCTCGAGATCATCTCATTCACCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181512.1-375s1c1
Sequence:CCGGGAAATGAACTAGACCTTGCGTCTCGAGACGCAAGGTCTAGTTCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181512.1-595s1c1
Sequence:CCGGGACAGAATCATGGCCAAGAATCTCGAGATTCTTGGCCATGATTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)