EMAIL THIS PAGE TO A FRIEND

MRPL22

mitochondrial ribosomal protein L22

69 Gene Product Result for
Synonyms: L22mt MRP-L22 MRP-L25 RPML25
UniProtKB ID: Q9NWU5, A6NGJ8, Q5H9Q1, Q96Q51, Q9P006
Gene ID:
Human(29093) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L22 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 4q. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(216767) mitochondrial ribosomal protein L22
Rat(287302) mitochondrial ribosomal protein L22
sheep(101110505) mitochondrial ribosomal protein L22
domestic guinea pig(100729278) mitochondrial ribosomal protein L22
naked mole-rat(101714422) mitochondrial ribosomal protein L22
Zebrafish(100142645) mitochondrial ribosomal protein L22
fruit fly(32662) mitochondrial ribosomal protein L22
chicken(416253) mitochondrial ribosomal protein L22
domestic cat(101095716) mitochondrial ribosomal protein L22
cow(614639) mitochondrial ribosomal protein L22
dog(479320) mitochondrial ribosomal protein L22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175001 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175001 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175001 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014990 Rosetta Predictions human pricing
NM_014180 Rosetta Predictions human pricing
NM_001105781 Rosetta Predictions rat pricing
NM_175001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306619 predicted 644
2 SASI_Hs02_00306620 predicted 761
3 SASI_Hs01_00077286 predicted 380
4 SASI_Hs01_00077287 predicted 511
5 SASI_Hs02_00306621 predicted 711
6 SASI_Hs02_00306622 predicted 390
7 SASI_Hs02_00306623 predicted 647
8 SASI_Hs02_00306624 predicted 538
9 SASI_Hs02_00306625 predicted 788
10 SASI_Hs02_00306626 predicted 656
11 SASI_Hs01_00077278 predicted 342
12 SASI_Hs01_00077279 predicted 343
13 SASI_Hs01_00077280 predicted 333
14 SASI_Hs01_00077281 predicted 353
15 SASI_Hs01_00077282 predicted 337
16 SASI_Hs01_00077283 predicted 356
17 SASI_Hs01_00077284 predicted 325
18 SASI_Hs01_00077285 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345192 predicted 768
2 SASI_Hs02_00345193 predicted 875
3 SASI_Hs01_00093486 predicted 495
4 SASI_Hs02_00345194 predicted 635
5 SASI_Hs02_00345195 predicted 827
6 SASI_Hs02_00345196 predicted 512
7 SASI_Hs02_00345197 predicted 764
8 SASI_Hs02_00345198 predicted 665
9 SASI_Hs02_00345199 predicted 908
10 SASI_Hs02_00345200 predicted 774
11 SASI_Hs01_00093487 predicted 463
12 SASI_Hs01_00093488 predicted 490
13 SASI_Hs01_00093489 predicted 483
14 SASI_Hs01_00093490 predicted 453
15 SASI_Hs01_00093491 predicted 446
16 SASI_Hs01_00093492 predicted 469
17 SASI_Hs01_00093493 predicted 493
18 SASI_Hs01_00093494 predicted 446
19 SASI_Hs01_00093495 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212466 predicted 361
2 SASI_Rn02_00212467 predicted 224
3 SASI_Rn02_00212468 predicted 392
4 SASI_Rn02_00212469 predicted 406
5 SASI_Rn02_00212470 predicted 486
6 SASI_Rn02_00212471 predicted 284
7 SASI_Rn02_00212472 predicted 393
8 SASI_Rn02_00212473 predicted 505
9 SASI_Rn02_00212474 predicted 364
10 SASI_Rn02_00212475 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087076 predicted 289
2 SASI_Mm01_00087077 predicted 487
3 SASI_Mm01_00087078 predicted 397
4 SASI_Mm01_00087079 predicted 348
5 SASI_Mm01_00087080 predicted 496
6 SASI_Mm01_00087081 predicted 201
7 SASI_Mm01_00087082 predicted 261
8 SASI_Mm01_00087083 predicted 454
9 SASI_Mm01_00087084 predicted 422
10 SASI_Mm01_00087085 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014180
VALIDATED
MRPL22 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L22
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_014180.2-383s1c1
Sequence:CCGGGATATGGCAGTGAGAGACCATCTCGAGATGGTCTCTCACTGCCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014180.2-294s1c1
Sequence:CCGGGAATGTCTATTGACCAGGCTTCTCGAGAAGCCTGGTCAATAGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014180.2-286s1c1
Sequence:CCGGGATACGAGGAATGTCTATTGACTCGAGTCAATAGACATTCCTCGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_014180.2-127s1c1
Sequence:CCGGCACAAGTGCTTCTCTTGACATCTCGAGATGTCAAGAGAAGCACTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014180.2-362s1c1
Sequence:CCGGGAGGTTCTCTTAGAAGCACAACTCGAGTTGTGCTTCTAAGAGAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_014180.2-260s1c1
Sequence:CCGGGACAAGATGTGGTATTTGGCACTCGAGTGCCAAATACCACATCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-375s21c1
Sequence:CCGGGAGGTTCTCTTAGAAGCACAACTCGAGTTGTGCTTCTAAGAGAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-140s21c1
Sequence:CCGGCACAAGTGCTTCTCTTGACATCTCGAGATGTCAAGAGAAGCACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-273s21c1
Sequence:CCGGGACAAGATGTGGTATTTGGCACTCGAGTGCCAAATACCACATCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-396s21c1
Sequence:CCGGGATATGGCAGTGAGAGACCATCTCGAGATGGTCTCTCACTGCCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014180
VALIDATED
MRPL22 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L22
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_014180.2-383s1c1
Sequence:CCGGGATATGGCAGTGAGAGACCATCTCGAGATGGTCTCTCACTGCCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014180.2-294s1c1
Sequence:CCGGGAATGTCTATTGACCAGGCTTCTCGAGAAGCCTGGTCAATAGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014180.2-286s1c1
Sequence:CCGGGATACGAGGAATGTCTATTGACTCGAGTCAATAGACATTCCTCGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_014180.2-127s1c1
Sequence:CCGGCACAAGTGCTTCTCTTGACATCTCGAGATGTCAAGAGAAGCACTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014180.2-362s1c1
Sequence:CCGGGAGGTTCTCTTAGAAGCACAACTCGAGTTGTGCTTCTAAGAGAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_014180.2-260s1c1
Sequence:CCGGGACAAGATGTGGTATTTGGCACTCGAGTGCCAAATACCACATCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-375s21c1
Sequence:CCGGGAGGTTCTCTTAGAAGCACAACTCGAGTTGTGCTTCTAAGAGAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-140s21c1
Sequence:CCGGCACAAGTGCTTCTCTTGACATCTCGAGATGTCAAGAGAAGCACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-273s21c1
Sequence:CCGGGACAAGATGTGGTATTTGGCACTCGAGTGCCAAATACCACATCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-396s21c1
Sequence:CCGGGATATGGCAGTGAGAGACCATCTCGAGATGGTCTCTCACTGCCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014180
VALIDATED
MRPL22 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L22
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_014180.2-383s1c1
Sequence:CCGGGATATGGCAGTGAGAGACCATCTCGAGATGGTCTCTCACTGCCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014180.2-294s1c1
Sequence:CCGGGAATGTCTATTGACCAGGCTTCTCGAGAAGCCTGGTCAATAGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014180.2-286s1c1
Sequence:CCGGGATACGAGGAATGTCTATTGACTCGAGTCAATAGACATTCCTCGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_014180.2-127s1c1
Sequence:CCGGCACAAGTGCTTCTCTTGACATCTCGAGATGTCAAGAGAAGCACTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014180.2-362s1c1
Sequence:CCGGGAGGTTCTCTTAGAAGCACAACTCGAGTTGTGCTTCTAAGAGAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_014180.2-260s1c1
Sequence:CCGGGACAAGATGTGGTATTTGGCACTCGAGTGCCAAATACCACATCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-375s21c1
Sequence:CCGGGAGGTTCTCTTAGAAGCACAACTCGAGTTGTGCTTCTAAGAGAACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-140s21c1
Sequence:CCGGCACAAGTGCTTCTCTTGACATCTCGAGATGTCAAGAGAAGCACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-273s21c1
Sequence:CCGGGACAAGATGTGGTATTTGGCACTCGAGTGCCAAATACCACATCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014180.3-396s21c1
Sequence:CCGGGATATGGCAGTGAGAGACCATCTCGAGATGGTCTCTCACTGCCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175001
VALIDATED
MRPL22 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L22
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-130s1c1
Sequence:CCGGCGAGTGCTTCTCTTGACATTTCTCGAGAAATGTCAAGAGAAGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-139s1c1
Sequence:CCGGCTCTTGACATTTCTCGCAAATCTCGAGATTTGCGAGAAATGTCAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-320s1c1
Sequence:CCGGGCAGCTGGAGTTCAATGATAACTCGAGTTATCATTGAACTCCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-348s1c1
Sequence:CCGGGCTCAAATCATTAAAGAGGTTCTCGAGAACCTCTTTAATGATTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-319s21c3
Sequence:CCGGGCAGCTGGAGTTCAATGATAACTCGAGTTATCATTGAACTCCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-207s21c1
Sequence:CCGGCTCGGAGACCAGCGGAAATTTCTCGAGAAATTTCCGCTGGTCTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-129s21c1
Sequence:CCGGCGAGTGCTTCTCTTGACATTTCTCGAGAAATGTCAAGAGAAGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-138s21c1
Sequence:CCGGCTCTTGACATTTCTCGCAAATCTCGAGATTTGCGAGAAATGTCAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-347s21c3
Sequence:CCGGGCTCAAATCATTAAAGAGGTTCTCGAGAACCTCTTTAATGATTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175001
VALIDATED
MRPL22 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L22
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-130s1c1
Sequence:CCGGCGAGTGCTTCTCTTGACATTTCTCGAGAAATGTCAAGAGAAGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-139s1c1
Sequence:CCGGCTCTTGACATTTCTCGCAAATCTCGAGATTTGCGAGAAATGTCAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-320s1c1
Sequence:CCGGGCAGCTGGAGTTCAATGATAACTCGAGTTATCATTGAACTCCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-348s1c1
Sequence:CCGGGCTCAAATCATTAAAGAGGTTCTCGAGAACCTCTTTAATGATTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-319s21c3
Sequence:CCGGGCAGCTGGAGTTCAATGATAACTCGAGTTATCATTGAACTCCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-207s21c1
Sequence:CCGGCTCGGAGACCAGCGGAAATTTCTCGAGAAATTTCCGCTGGTCTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-129s21c1
Sequence:CCGGCGAGTGCTTCTCTTGACATTTCTCGAGAAATGTCAAGAGAAGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-138s21c1
Sequence:CCGGCTCTTGACATTTCTCGCAAATCTCGAGATTTGCGAGAAATGTCAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-347s21c3
Sequence:CCGGGCTCAAATCATTAAAGAGGTTCTCGAGAACCTCTTTAATGATTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175001
VALIDATED
MRPL22 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L22
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-130s1c1
Sequence:CCGGCGAGTGCTTCTCTTGACATTTCTCGAGAAATGTCAAGAGAAGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-139s1c1
Sequence:CCGGCTCTTGACATTTCTCGCAAATCTCGAGATTTGCGAGAAATGTCAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-320s1c1
Sequence:CCGGGCAGCTGGAGTTCAATGATAACTCGAGTTATCATTGAACTCCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175001.1-348s1c1
Sequence:CCGGGCTCAAATCATTAAAGAGGTTCTCGAGAACCTCTTTAATGATTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-319s21c3
Sequence:CCGGGCAGCTGGAGTTCAATGATAACTCGAGTTATCATTGAACTCCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-207s21c1
Sequence:CCGGCTCGGAGACCAGCGGAAATTTCTCGAGAAATTTCCGCTGGTCTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-129s21c1
Sequence:CCGGCGAGTGCTTCTCTTGACATTTCTCGAGAAATGTCAAGAGAAGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-138s21c1
Sequence:CCGGCTCTTGACATTTCTCGCAAATCTCGAGATTTGCGAGAAATGTCAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175001.2-347s21c3
Sequence:CCGGGCTCAAATCATTAAAGAGGTTCTCGAGAACCTCTTTAATGATTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)