EMAIL THIS PAGE TO A FRIEND

MRPL23

mitochondrial ribosomal protein L23

44 Gene Product Result for
Synonyms: L23MRP RPL23 RPL23L
UniProtKB ID: Q16540, A8MT29, Q96Q71
Gene ID:
Human(6150) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. The gene is biallelically expressed, despite its location within a region of imprinted genes on chromosome 11. [provided by RefSeq, Jul 2008]
Mouse(19935) mitochondrial ribosomal protein L23
Rat(64360) mitochondrial ribosomal protein L23
Zebrafish(415142) mitochondrial ribosomal protein L23
fruit fly(38302) mitochondrial ribosomal protein L23
dog(483663) mitochondrial ribosomal protein L23
cow(508825) mitochondrial ribosomal protein L23
Horse(100060108) mitochondrial ribosomal protein L23
chicken(374255) mitochondrial ribosomal protein L23
naked mole-rat(101718918) mitochondrial ribosomal protein L23
domestic guinea pig(100734429) mitochondrial ribosomal protein L23
sheep(101104725) mitochondrial ribosomal protein L23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021134 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091301 MISSION® esiRNA esiRNA targeting mouse Mrpl23 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021134 Rosetta Predictions human pricing
NM_022529 Rosetta Predictions rat pricing
NM_011288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029670 predicted 307
2 SASI_Hs01_00029671 predicted 212
3 SASI_Hs01_00029672 predicted 375
4 SASI_Hs02_00354656 predicted 359
5 SASI_Hs01_00029673 predicted 321
6 SASI_Hs01_00029675 predicted 268
7 SASI_Hs01_00029676 predicted 337
8 SASI_Hs01_00029677 predicted 362
9 SASI_Hs01_00029678 predicted 371
10 SASI_Hs01_00029679 predicted 304
11 SASI_Hs01_00029674 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121806 predicted 255
2 SASI_Rn01_00121807 predicted 309
3 SASI_Rn01_00121808 predicted 270
4 SASI_Rn01_00121810 predicted 235
5 SASI_Rn01_00121811 predicted 246
6 SASI_Rn01_00121812 predicted 305
7 SASI_Rn01_00121813 predicted 282
8 SASI_Rn01_00121814 predicted 267
9 SASI_Rn01_00121815 predicted 225
10 SASI_Rn02_00263277 predicted 271
11 SASI_Rn01_00121809 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200620 predicted 217
2 SASI_Mm01_00200621 predicted 218
3 SASI_Mm01_00200622 predicted 202
4 SASI_Mm01_00200623 predicted 207
5 SASI_Mm01_00200624 predicted 353
6 SASI_Mm01_00200625 predicted 359
7 SASI_Mm01_00200626 predicted 313
8 SASI_Mm01_00200627 predicted 224
9 SASI_Mm01_00200628 predicted 314
10 SASI_Mm01_00200629 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011288
VALIDATED
MRPL23 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L23
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-166s21c1
Sequence:CCGGGCCTGAAGATACCGTGCAGTTCTCGAGAACTGCACGGTATCTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-316s21c1
Sequence:CCGGGAGGATCAAGAAACCAGACTACTCGAGTAGTCTGGTTTCTTGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-109s21c1
Sequence:CCGGGCTCCGTGTATTTCGAACTAACTCGAGTTAGTTCGAAATACACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-220s21c1
Sequence:CCGGTCGGAATTACCTTGAGCAGATCTCGAGATCTGCTCAAGGTAATTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-221s1c1
Sequence:CCGGCGGAATTACCTTGAGCAGATTCTCGAGAATCTGCTCAAGGTAATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-220s1c1
Sequence:CCGGTCGGAATTACCTTGAGCAGATCTCGAGATCTGCTCAAGGTAATTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-316s1c1
Sequence:CCGGGAGGATCAAGAAACCAGACTACTCGAGTAGTCTGGTTTCTTGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-166s1c1
Sequence:CCGGGCCTGAAGATACCGTGCAGTTCTCGAGAACTGCACGGTATCTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-109s1c1
Sequence:CCGGGCTCCGTGTATTTCGAACTAACTCGAGTTAGTTCGAAATACACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011288
VALIDATED
MRPL23 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L23
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-166s21c1
Sequence:CCGGGCCTGAAGATACCGTGCAGTTCTCGAGAACTGCACGGTATCTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-316s21c1
Sequence:CCGGGAGGATCAAGAAACCAGACTACTCGAGTAGTCTGGTTTCTTGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-109s21c1
Sequence:CCGGGCTCCGTGTATTTCGAACTAACTCGAGTTAGTTCGAAATACACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-220s21c1
Sequence:CCGGTCGGAATTACCTTGAGCAGATCTCGAGATCTGCTCAAGGTAATTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-221s1c1
Sequence:CCGGCGGAATTACCTTGAGCAGATTCTCGAGAATCTGCTCAAGGTAATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-220s1c1
Sequence:CCGGTCGGAATTACCTTGAGCAGATCTCGAGATCTGCTCAAGGTAATTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-316s1c1
Sequence:CCGGGAGGATCAAGAAACCAGACTACTCGAGTAGTCTGGTTTCTTGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-166s1c1
Sequence:CCGGGCCTGAAGATACCGTGCAGTTCTCGAGAACTGCACGGTATCTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-109s1c1
Sequence:CCGGGCTCCGTGTATTTCGAACTAACTCGAGTTAGTTCGAAATACACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011288
VALIDATED
MRPL23 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L23
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-166s21c1
Sequence:CCGGGCCTGAAGATACCGTGCAGTTCTCGAGAACTGCACGGTATCTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-316s21c1
Sequence:CCGGGAGGATCAAGAAACCAGACTACTCGAGTAGTCTGGTTTCTTGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-109s21c1
Sequence:CCGGGCTCCGTGTATTTCGAACTAACTCGAGTTAGTTCGAAATACACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011288.1-220s21c1
Sequence:CCGGTCGGAATTACCTTGAGCAGATCTCGAGATCTGCTCAAGGTAATTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-221s1c1
Sequence:CCGGCGGAATTACCTTGAGCAGATTCTCGAGAATCTGCTCAAGGTAATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-220s1c1
Sequence:CCGGTCGGAATTACCTTGAGCAGATCTCGAGATCTGCTCAAGGTAATTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-316s1c1
Sequence:CCGGGAGGATCAAGAAACCAGACTACTCGAGTAGTCTGGTTTCTTGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-166s1c1
Sequence:CCGGGCCTGAAGATACCGTGCAGTTCTCGAGAACTGCACGGTATCTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011288.1-109s1c1
Sequence:CCGGGCTCCGTGTATTTCGAACTAACTCGAGTTAGTTCGAAATACACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021134
VALIDATED
MRPL23 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L23
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021134.3-148s21c1
Sequence:CCGGGTTCCGAACCAACTTCTTCATCTCGAGATGAAGAAGTTGGTTCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021134.3-337s21c1
Sequence:CCGGCAGAAACGTGAGGATCAAGAACTCGAGTTCTTGATCCTCACGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021134.3-226s21c1
Sequence:CCGGCATGGAAATGACAAGGGTGGACTCGAGTCCACCCTTGTCATTTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021134.3-309s21c1
Sequence:CCGGAGCATGGCTCTAACAAGAGAACTCGAGTTCTCTTGTTAGAGCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021134.3-413s21c1
Sequence:CCGGCCAGATCTGTTTCCCGAGAAACTCGAGTTTCTCGGGAAACAGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-190s1c1
Sequence:CCGGCATGGAAATGACAAGGGTGGACTCGAGTCCACCCTTGTCATTTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-377s1c1
Sequence:CCGGCCAGATCTGTTTCCCGAGAAACTCGAGTTTCTCGGGAAACAGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-273s1c1
Sequence:CCGGAGCATGGCTCTAACAAGAGAACTCGAGTTCTCTTGTTAGAGCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-301s1c1
Sequence:CCGGCAGAAACGTGAGGATCAAGAACTCGAGTTCTTGATCCTCACGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-112s1c1
Sequence:CCGGGTTCCGAACCAACTTCTTCATCTCGAGATGAAGAAGTTGGTTCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021134
VALIDATED
MRPL23 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L23
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021134.3-148s21c1
Sequence:CCGGGTTCCGAACCAACTTCTTCATCTCGAGATGAAGAAGTTGGTTCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021134.3-337s21c1
Sequence:CCGGCAGAAACGTGAGGATCAAGAACTCGAGTTCTTGATCCTCACGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021134.3-226s21c1
Sequence:CCGGCATGGAAATGACAAGGGTGGACTCGAGTCCACCCTTGTCATTTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021134.3-309s21c1
Sequence:CCGGAGCATGGCTCTAACAAGAGAACTCGAGTTCTCTTGTTAGAGCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021134.3-413s21c1
Sequence:CCGGCCAGATCTGTTTCCCGAGAAACTCGAGTTTCTCGGGAAACAGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-190s1c1
Sequence:CCGGCATGGAAATGACAAGGGTGGACTCGAGTCCACCCTTGTCATTTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-377s1c1
Sequence:CCGGCCAGATCTGTTTCCCGAGAAACTCGAGTTTCTCGGGAAACAGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-273s1c1
Sequence:CCGGAGCATGGCTCTAACAAGAGAACTCGAGTTCTCTTGTTAGAGCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-301s1c1
Sequence:CCGGCAGAAACGTGAGGATCAAGAACTCGAGTTCTTGATCCTCACGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-112s1c1
Sequence:CCGGGTTCCGAACCAACTTCTTCATCTCGAGATGAAGAAGTTGGTTCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021134
VALIDATED
MRPL23 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L23
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021134.3-148s21c1
Sequence:CCGGGTTCCGAACCAACTTCTTCATCTCGAGATGAAGAAGTTGGTTCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021134.3-337s21c1
Sequence:CCGGCAGAAACGTGAGGATCAAGAACTCGAGTTCTTGATCCTCACGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021134.3-226s21c1
Sequence:CCGGCATGGAAATGACAAGGGTGGACTCGAGTCCACCCTTGTCATTTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021134.3-309s21c1
Sequence:CCGGAGCATGGCTCTAACAAGAGAACTCGAGTTCTCTTGTTAGAGCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021134.3-413s21c1
Sequence:CCGGCCAGATCTGTTTCCCGAGAAACTCGAGTTTCTCGGGAAACAGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-190s1c1
Sequence:CCGGCATGGAAATGACAAGGGTGGACTCGAGTCCACCCTTGTCATTTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-377s1c1
Sequence:CCGGCCAGATCTGTTTCCCGAGAAACTCGAGTTTCTCGGGAAACAGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-273s1c1
Sequence:CCGGAGCATGGCTCTAACAAGAGAACTCGAGTTCTCTTGTTAGAGCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-301s1c1
Sequence:CCGGCAGAAACGTGAGGATCAAGAACTCGAGTTCTTGATCCTCACGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021134.2-112s1c1
Sequence:CCGGGTTCCGAACCAACTTCTTCATCTCGAGATGAAGAAGTTGGTTCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)