EMAIL THIS PAGE TO A FRIEND

MRPL27

mitochondrial ribosomal protein L27

54 Gene Product Result for
Synonyms: L27mt
UniProtKB ID: Q9P0M9, B2RE14
Gene ID:
Human(51264) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(94064) mitochondrial ribosomal protein L27
Rat(287635) mitochondrial ribosomal protein L27
Zebrafish(553709) mitochondrial ribosomal protein L27
cow(510058) mitochondrial ribosomal protein L27
domestic cat(101091738) mitochondrial ribosomal protein L27
dog(491078) mitochondrial ribosomal protein L27
chicken(422105) mitochondrial ribosomal protein L27
fruit fly(318825) mitochondrial ribosomal protein L27
naked mole-rat(101704274) mitochondrial ribosomal protein L27
domestic guinea pig(100732925) mitochondrial ribosomal protein L27
sheep(101106861) mitochondrial ribosomal protein L27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016504 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016504 Rosetta Predictions human pricing
NM_148570 Rosetta Predictions human pricing
NM_148571 Rosetta Predictions human pricing
NM_001105831 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143506 predicted 457
2 SASI_Hs01_00143507 predicted 482
3 SASI_Hs01_00143508 predicted 339
4 SASI_Hs01_00143510 predicted 365
5 SASI_Hs02_00349573 predicted 292
6 SASI_Hs01_00143512 predicted 314
7 SASI_Hs01_00143513 predicted 462
8 SASI_Hs01_00143514 predicted 243
9 SASI_Hs02_00349574 predicted 310
10 SASI_Hs02_00349575 predicted 337
11 SASI_Hs01_00143505 predicted 266
12 SASI_Hs01_00143509 predicted 270
13 SASI_Hs01_00143511 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046668 predicted 482
2 SASI_Hs01_00046669 predicted 378
3 SASI_Hs01_00046670 predicted 507
4 SASI_Hs01_00046671 predicted 360
5 SASI_Hs01_00046672 predicted 392
6 SASI_Hs01_00046673 predicted 338
7 SASI_Hs01_00046674 predicted 486
8 SASI_Hs01_00046675 predicted 379
9 SASI_Hs01_00046676 predicted 412
10 SASI_Hs01_00046677 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085353 predicted 818
2 SASI_Hs01_00085354 predicted 540
3 SASI_Hs01_00085355 predicted 694
4 SASI_Hs01_00085356 predicted 551
5 SASI_Hs01_00085357 predicted 639
6 SASI_Hs01_00085358 predicted 544
7 SASI_Hs01_00085359 predicted 71
8 SASI_Hs01_00085360 predicted 714
9 SASI_Hs01_00085361 predicted 719
10 SASI_Hs01_00085362 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212956 predicted 285
2 SASI_Rn02_00212957 predicted 309
3 SASI_Rn02_00212958 predicted 333
4 SASI_Rn02_00212959 predicted 439
5 SASI_Rn02_00212960 predicted 206
6 SASI_Rn02_00212961 predicted 305
7 SASI_Rn02_00212962 predicted 335
8 SASI_Rn02_00212963 predicted 420
9 SASI_Rn02_00212964 predicted 461
10 SASI_Rn02_00212965 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053161
VALIDATED
MRPL27 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L27
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-302s21c1
Sequence:CCGGCCGCTACACGAAAGATGTCTACTCGAGTAGACATCTTTCGTGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053161.2-610s21c1
Sequence:CCGGCCTGAGTTCAATTCCCAACAACTCGAGTTGTTGGGAATTGAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-423s21c1
Sequence:CCGGCCTGAGGGAACCTTCAAACTACTCGAGTAGTTTGAAGGTTCCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-152s21c1
Sequence:CCGGAGGCAAACACTACGGCATCAACTCGAGTTGATGCCGTAGTGTTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-214s21c1
Sequence:CCGGGCACTCAGCGTCAGTTTAGATCTCGAGATCTAAACTGACGCTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-610s1c1
Sequence:CCGGCCTGAGTTCAATTCCCAACAACTCGAGTTGTTGGGAATTGAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-423s1c1
Sequence:CCGGCCTGAGGGAACCTTCAAACTACTCGAGTAGTTTGAAGGTTCCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053161.2-214s1c1
Sequence:CCGGGCACTCAGCGTCAGTTTAGATCTCGAGATCTAAACTGACGCTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-152s1c1
Sequence:CCGGAGGCAAACACTACGGCATCAACTCGAGTTGATGCCGTAGTGTTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-302s1c1
Sequence:CCGGCCGCTACACGAAAGATGTCTACTCGAGTAGACATCTTTCGTGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053161
VALIDATED
MRPL27 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L27
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-302s21c1
Sequence:CCGGCCGCTACACGAAAGATGTCTACTCGAGTAGACATCTTTCGTGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053161.2-610s21c1
Sequence:CCGGCCTGAGTTCAATTCCCAACAACTCGAGTTGTTGGGAATTGAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-423s21c1
Sequence:CCGGCCTGAGGGAACCTTCAAACTACTCGAGTAGTTTGAAGGTTCCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-152s21c1
Sequence:CCGGAGGCAAACACTACGGCATCAACTCGAGTTGATGCCGTAGTGTTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-214s21c1
Sequence:CCGGGCACTCAGCGTCAGTTTAGATCTCGAGATCTAAACTGACGCTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-610s1c1
Sequence:CCGGCCTGAGTTCAATTCCCAACAACTCGAGTTGTTGGGAATTGAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-423s1c1
Sequence:CCGGCCTGAGGGAACCTTCAAACTACTCGAGTAGTTTGAAGGTTCCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053161.2-214s1c1
Sequence:CCGGGCACTCAGCGTCAGTTTAGATCTCGAGATCTAAACTGACGCTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-152s1c1
Sequence:CCGGAGGCAAACACTACGGCATCAACTCGAGTTGATGCCGTAGTGTTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-302s1c1
Sequence:CCGGCCGCTACACGAAAGATGTCTACTCGAGTAGACATCTTTCGTGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053161
VALIDATED
MRPL27 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L27
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-302s21c1
Sequence:CCGGCCGCTACACGAAAGATGTCTACTCGAGTAGACATCTTTCGTGTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053161.2-610s21c1
Sequence:CCGGCCTGAGTTCAATTCCCAACAACTCGAGTTGTTGGGAATTGAACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-423s21c1
Sequence:CCGGCCTGAGGGAACCTTCAAACTACTCGAGTAGTTTGAAGGTTCCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-152s21c1
Sequence:CCGGAGGCAAACACTACGGCATCAACTCGAGTTGATGCCGTAGTGTTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053161.2-214s21c1
Sequence:CCGGGCACTCAGCGTCAGTTTAGATCTCGAGATCTAAACTGACGCTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-610s1c1
Sequence:CCGGCCTGAGTTCAATTCCCAACAACTCGAGTTGTTGGGAATTGAACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-423s1c1
Sequence:CCGGCCTGAGGGAACCTTCAAACTACTCGAGTAGTTTGAAGGTTCCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053161.2-214s1c1
Sequence:CCGGGCACTCAGCGTCAGTTTAGATCTCGAGATCTAAACTGACGCTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-152s1c1
Sequence:CCGGAGGCAAACACTACGGCATCAACTCGAGTTGATGCCGTAGTGTTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053161.2-302s1c1
Sequence:CCGGCCGCTACACGAAAGATGTCTACTCGAGTAGACATCTTTCGTGTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016504
VALIDATED
MRPL27 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L27
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-67s21c1
Sequence:CCGGAGCCGTTACATCCTTGCTAAGCTCGAGCTTAGCAAGGATGTAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-452s21c1
Sequence:CCGGACCTTCAAACTGGTAGCTATGCTCGAGCATAGCTACCAGTTTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-314s21c1
Sequence:CCGGGGGATAGTCCGCTACACTAAGCTCGAGCTTAGTGTAGCGGACTATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-341s21c1
Sequence:CCGGTACGTGCCTCATCCCAGAAACCTCGAGGTTTCTGGGATGAGGCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-526s21c1
Sequence:CCGGGATGGTGATACCAGAAGTCAACTCGAGTTGACTTCTGGTATCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016504.2-286s1c1
Sequence:CCGGGAATAAATGTCTGTATGCCCTCTCGAGAGGGCATACAGACATTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016504.2-175s1c1
Sequence:CCGGCAGACGCCAAGGCATTAAGAACTCGAGTTCTTAATGCCTTGGCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016504.2-526s1c1
Sequence:CCGGGATGGTGATACCAGAAGTCAACTCGAGTTGACTTCTGGTATCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016504.2-208s1c1
Sequence:CCGGCTATGTTCATGCTGGGAACATCTCGAGATGTTCCCAGCATGAACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016504.2-278s1c1
Sequence:CCGGGTTGGGAAGAATAAATGTCTGCTCGAGCAGACATTTATTCTTCCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016504.2-272s1c1
Sequence:CCGGGTGGGTGTTGGGAAGAATAAACTCGAGTTTATTCTTCCCAACACCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016504
VALIDATED
MRPL27 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L27
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-67s21c1
Sequence:CCGGAGCCGTTACATCCTTGCTAAGCTCGAGCTTAGCAAGGATGTAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-452s21c1
Sequence:CCGGACCTTCAAACTGGTAGCTATGCTCGAGCATAGCTACCAGTTTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-314s21c1
Sequence:CCGGGGGATAGTCCGCTACACTAAGCTCGAGCTTAGTGTAGCGGACTATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-341s21c1
Sequence:CCGGTACGTGCCTCATCCCAGAAACCTCGAGGTTTCTGGGATGAGGCACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-526s21c1
Sequence:CCGGGATGGTGATACCAGAAGTCAACTCGAGTTGACTTCTGGTATCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016504.2-286s1c1
Sequence:CCGGGAATAAATGTCTGTATGCCCTCTCGAGAGGGCATACAGACATTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016504.2-175s1c1
Sequence:CCGGCAGACGCCAAGGCATTAAGAACTCGAGTTCTTAATGCCTTGGCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016504.2-526s1c1
Sequence:CCGGGATGGTGATACCAGAAGTCAACTCGAGTTGACTTCTGGTATCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016504.2-208s1c1
Sequence:CCGGCTATGTTCATGCTGGGAACATCTCGAGATGTTCCCAGCATGAACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016504.2-278s1c1
Sequence:CCGGGTTGGGAAGAATAAATGTCTGCTCGAGCAGACATTTATTCTTCCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016504.2-272s1c1
Sequence:CCGGGTGGGTGTTGGGAAGAATAAACTCGAGTTTATTCTTCCCAACACCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016504
VALIDATED
MRPL27 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L27
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-67s21c1
Sequence:CCGGAGCCGTTACATCCTTGCTAAGCTCGAGCTTAGCAAGGATGTAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-452s21c1
Sequence:CCGGACCTTCAAACTGGTAGCTATGCTCGAGCATAGCTACCAGTTTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-314s21c1
Sequence:CCGGGGGATAGTCCGCTACACTAAGCTCGAGCTTAGTGTAGCGGACTATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-341s21c1
Sequence:CCGGTACGTGCCTCATCCCAGAAACCTCGAGGTTTCTGGGATGAGGCACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016504.2-526s21c1
Sequence:CCGGGATGGTGATACCAGAAGTCAACTCGAGTTGACTTCTGGTATCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016504.2-286s1c1
Sequence:CCGGGAATAAATGTCTGTATGCCCTCTCGAGAGGGCATACAGACATTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016504.2-175s1c1
Sequence:CCGGCAGACGCCAAGGCATTAAGAACTCGAGTTCTTAATGCCTTGGCGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016504.2-526s1c1
Sequence:CCGGGATGGTGATACCAGAAGTCAACTCGAGTTGACTTCTGGTATCACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016504.2-208s1c1
Sequence:CCGGCTATGTTCATGCTGGGAACATCTCGAGATGTTCCCAGCATGAACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016504.2-278s1c1
Sequence:CCGGGTTGGGAAGAATAAATGTCTGCTCGAGCAGACATTTATTCTTCCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016504.2-272s1c1
Sequence:CCGGGTGGGTGTTGGGAAGAATAAACTCGAGTTTATTCTTCCCAACACCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)