EMAIL THIS PAGE TO A FRIEND

MRPL28

mitochondrial ribosomal protein L28

59 Gene Product Result for
Synonyms: MAAT1 p15
Gene ID:
Human(10573) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein, a part of which was originally isolated by its ability to recognize tyrosinase in an HLA-A24-restricted fashion. [provided by RefSeq, Jul 2008]
Mouse(68611) mitochondrial ribosomal protein L28
Rat(497876) mitochondrial ribosomal protein L28
sheep(101109581) mitochondrial ribosomal protein L28
domestic guinea pig(100713704) mitochondrial ribosomal protein L28
naked mole-rat(101700195) mitochondrial ribosomal protein L28
Zebrafish(554098) mitochondrial ribosomal protein L28
fruit fly(33715) mitochondrial ribosomal protein L28
chicken(426121) mitochondrial ribosomal protein L28
domestic cat(101096028) mitochondrial ribosomal protein L28
cow(508216) mitochondrial ribosomal protein L28
dog(479897) mitochondrial ribosomal protein L28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006428 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006428 Rosetta Predictions human pricing
XM_001061401 Rosetta Predictions rat pricing
XM_573060 Rosetta Predictions rat pricing
NM_024227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047808 predicted 868
2 SASI_Hs01_00047809 predicted 450
3 SASI_Hs01_00047810 predicted 506
4 SASI_Hs01_00047811 predicted 367
5 SASI_Hs01_00047813 predicted 598
6 SASI_Hs01_00047814 predicted 444
7 SASI_Hs02_00341550 predicted 598
8 SASI_Hs01_00047815 predicted 292
9 SASI_Hs01_00047816 predicted 293
10 SASI_Hs02_00341551 predicted 671
11 SASI_Hs01_00047812 predicted 418
12 SASI_Hs01_00047817 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299937 predicted 542
2 SASI_Rn02_00299938 predicted 536
3 SASI_Rn02_00299939 predicted 591
4 SASI_Rn02_00299940 predicted 492
5 SASI_Rn02_00299941 predicted 306
6 SASI_Rn02_00299942 predicted 482
7 SASI_Rn02_00299943 predicted 440
8 SASI_Rn02_00299944 predicted 199
9 SASI_Rn02_00299945 predicted 319
10 SASI_Rn02_00299946 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399706 predicted 541
2 SASI_Rn02_00399707 predicted 541
3 SASI_Rn02_00399708 predicted 584
4 SASI_Rn02_00399709 predicted 496
5 SASI_Rn02_00399710 predicted 308
6 SASI_Rn02_00399711 predicted 486
7 SASI_Rn02_00399712 predicted 440
8 SASI_Rn02_00399713 predicted 199
9 SASI_Rn02_00399714 predicted 313
10 SASI_Rn02_00399715 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056126 predicted 442
2 SASI_Mm02_00327597 predicted 350
3 SASI_Mm01_00056127 predicted 439
4 SASI_Mm01_00056128 predicted 210
5 SASI_Mm01_00056129 predicted 485
6 SASI_Mm01_00056130 predicted 379
7 SASI_Mm01_00056132 predicted 427
8 SASI_Mm01_00056133 predicted 699
9 SASI_Mm01_00056134 predicted 578
10 SASI_Mm01_00056135 predicted 410
11 SASI_Mm01_00056131 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006428
VALIDATED
MRPL28 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L28
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-346s21c1
Sequence:CCGGGAGGCTGAAGAAAGTGTGGAACTCGAGTTCCACACTTTCTTCAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-346s1c1
Sequence:CCGGGAGGCTGAAGAAAGTGTGGAACTCGAGTTCCACACTTTCTTCAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-409s1c1
Sequence:CCGGCAAGAAGTTCACAGTGACTGTCTCGAGACAGTCACTGTGAACTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-680s1c1
Sequence:CCGGGCCATTGAGAAGCAGAGACTTCTCGAGAAGTCTCTGCTTCTCAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-622s21c1
Sequence:CCGGCAAGGAATTTGCCATCCCAGACTCGAGTCTGGGATGGCAAATTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-514s21c1
Sequence:CCGGCAAGTTTGGGATGGACCTGAACTCGAGTTCAGGTCCATCCCAAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-680s21c1
Sequence:CCGGGCCATTGAGAAGCAGAGACTTCTCGAGAAGTCTCTGCTTCTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-409s21c1
Sequence:CCGGCAAGAAGTTCACAGTGACTGTCTCGAGACAGTCACTGTGAACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006428.3-514s1c1
Sequence:CCGGCAAGTTTGGGATGGACCTGAACTCGAGTTCAGGTCCATCCCAAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-622s1c1
Sequence:CCGGCAAGGAATTTGCCATCCCAGACTCGAGTCTGGGATGGCAAATTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006428
VALIDATED
MRPL28 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L28
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-346s21c1
Sequence:CCGGGAGGCTGAAGAAAGTGTGGAACTCGAGTTCCACACTTTCTTCAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-346s1c1
Sequence:CCGGGAGGCTGAAGAAAGTGTGGAACTCGAGTTCCACACTTTCTTCAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-409s1c1
Sequence:CCGGCAAGAAGTTCACAGTGACTGTCTCGAGACAGTCACTGTGAACTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-680s1c1
Sequence:CCGGGCCATTGAGAAGCAGAGACTTCTCGAGAAGTCTCTGCTTCTCAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-622s21c1
Sequence:CCGGCAAGGAATTTGCCATCCCAGACTCGAGTCTGGGATGGCAAATTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-514s21c1
Sequence:CCGGCAAGTTTGGGATGGACCTGAACTCGAGTTCAGGTCCATCCCAAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-680s21c1
Sequence:CCGGGCCATTGAGAAGCAGAGACTTCTCGAGAAGTCTCTGCTTCTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-409s21c1
Sequence:CCGGCAAGAAGTTCACAGTGACTGTCTCGAGACAGTCACTGTGAACTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006428.3-514s1c1
Sequence:CCGGCAAGTTTGGGATGGACCTGAACTCGAGTTCAGGTCCATCCCAAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-622s1c1
Sequence:CCGGCAAGGAATTTGCCATCCCAGACTCGAGTCTGGGATGGCAAATTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006428
VALIDATED
MRPL28 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L28
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-346s21c1
Sequence:CCGGGAGGCTGAAGAAAGTGTGGAACTCGAGTTCCACACTTTCTTCAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-346s1c1
Sequence:CCGGGAGGCTGAAGAAAGTGTGGAACTCGAGTTCCACACTTTCTTCAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-409s1c1
Sequence:CCGGCAAGAAGTTCACAGTGACTGTCTCGAGACAGTCACTGTGAACTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-680s1c1
Sequence:CCGGGCCATTGAGAAGCAGAGACTTCTCGAGAAGTCTCTGCTTCTCAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-622s21c1
Sequence:CCGGCAAGGAATTTGCCATCCCAGACTCGAGTCTGGGATGGCAAATTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-514s21c1
Sequence:CCGGCAAGTTTGGGATGGACCTGAACTCGAGTTCAGGTCCATCCCAAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-680s21c1
Sequence:CCGGGCCATTGAGAAGCAGAGACTTCTCGAGAAGTCTCTGCTTCTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006428.3-409s21c1
Sequence:CCGGCAAGAAGTTCACAGTGACTGTCTCGAGACAGTCACTGTGAACTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006428.3-514s1c1
Sequence:CCGGCAAGTTTGGGATGGACCTGAACTCGAGTTCAGGTCCATCCCAAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006428.3-622s1c1
Sequence:CCGGCAAGGAATTTGCCATCCCAGACTCGAGTCTGGGATGGCAAATTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024227
VALIDATED
MRPL28 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L28
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-291s21c1
Sequence:CCGGAGGCTACAGATACGCCAACAACTCGAGTTGTTGGCGTATCTGTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024227.2-442s1c1
Sequence:CCGGGCCTATGGATTTGACTTCTATCTCGAGATAGAAGTCAAATCCATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-866s21c1
Sequence:CCGGACAGTTCCTGTGGTAGACTTTCTCGAGAAAGTCTACCACAGGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-363s21c1
Sequence:CCGGTCGGGAGCTTTACAGTGAAATCTCGAGATTTCACTGTAAAGCTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-169s21c1
Sequence:CCGGGGGACCAAGTTCAAGATCAACCTCGAGGTTGATCTTGAACTTGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-433s21c1
Sequence:CCGGATCGATGAGGCCTATGGATTTCTCGAGAAATCCATAGGCCTCATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024227
VALIDATED
MRPL28 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L28
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-291s21c1
Sequence:CCGGAGGCTACAGATACGCCAACAACTCGAGTTGTTGGCGTATCTGTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024227.2-442s1c1
Sequence:CCGGGCCTATGGATTTGACTTCTATCTCGAGATAGAAGTCAAATCCATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-866s21c1
Sequence:CCGGACAGTTCCTGTGGTAGACTTTCTCGAGAAAGTCTACCACAGGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-363s21c1
Sequence:CCGGTCGGGAGCTTTACAGTGAAATCTCGAGATTTCACTGTAAAGCTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-169s21c1
Sequence:CCGGGGGACCAAGTTCAAGATCAACCTCGAGGTTGATCTTGAACTTGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-433s21c1
Sequence:CCGGATCGATGAGGCCTATGGATTTCTCGAGAAATCCATAGGCCTCATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024227
VALIDATED
MRPL28 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L28
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-291s21c1
Sequence:CCGGAGGCTACAGATACGCCAACAACTCGAGTTGTTGGCGTATCTGTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024227.2-442s1c1
Sequence:CCGGGCCTATGGATTTGACTTCTATCTCGAGATAGAAGTCAAATCCATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-866s21c1
Sequence:CCGGACAGTTCCTGTGGTAGACTTTCTCGAGAAAGTCTACCACAGGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-363s21c1
Sequence:CCGGTCGGGAGCTTTACAGTGAAATCTCGAGATTTCACTGTAAAGCTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-169s21c1
Sequence:CCGGGGGACCAAGTTCAAGATCAACCTCGAGGTTGATCTTGAACTTGGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024227.2-433s21c1
Sequence:CCGGATCGATGAGGCCTATGGATTTCTCGAGAAATCCATAGGCCTCATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)