EMAIL THIS PAGE TO A FRIEND

MRPL2

mitochondrial ribosomal protein L2

48 Gene Product Result for
Synonyms: MRP-L14 RPML14
UniProtKB ID: Q5T653, B2RC56, Q8WUL1, Q96Q56, Q9Y311
Gene ID:
Human(51069) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the EcoL2 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 12q. [provided by RefSeq, Jul 2008]
Mouse(27398) mitochondrial ribosomal protein L2
Rat(301240) mitochondrial ribosomal protein L2
fruit fly(39253) mitochondrial ribosomal protein L2
dog(474908) mitochondrial ribosomal protein L2
cow(514403) mitochondrial ribosomal protein L2
domestic cat(101093357) mitochondrial ribosomal protein L2
chicken(421256) mitochondrial ribosomal protein L2
naked mole-rat(101721461) mitochondrial ribosomal protein L2
domestic guinea pig(100734554) mitochondrial ribosomal protein L2
sheep(101113180) mitochondrial ribosomal protein L2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015950 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015950 Rosetta Predictions human pricing
NM_001034136 Rosetta Predictions rat pricing
NM_025302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087430 predicted 629
2 SASI_Hs01_00087431 predicted 302
3 SASI_Hs01_00087432 predicted 564
4 SASI_Hs01_00087433 predicted 829
5 SASI_Hs01_00087434 predicted 421
6 SASI_Hs01_00087435 predicted 417
7 SASI_Hs01_00087436 predicted 382
8 SASI_Hs01_00087437 predicted 338
9 SASI_Hs01_00087439 predicted 321
10 SASI_Hs02_00348591 predicted 616
11 SASI_Hs01_00087438 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033928 predicted 496
2 SASI_Rn01_00033929 predicted 231
3 SASI_Rn01_00033930 predicted 328
4 SASI_Rn01_00033931 predicted 289
5 SASI_Rn01_00033932 predicted 592
6 SASI_Rn01_00033933 predicted 472
7 SASI_Rn01_00033934 predicted 315
8 SASI_Rn01_00033935 predicted 664
9 SASI_Rn01_00033936 predicted 403
10 SASI_Rn01_00033937 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031193 predicted 774
2 SASI_Mm01_00031195 predicted 258
3 SASI_Mm01_00031196 predicted 498
4 SASI_Mm01_00031197 predicted 764
5 SASI_Mm01_00031198 predicted 545
6 SASI_Mm01_00031199 predicted 418
7 SASI_Mm01_00031200 predicted 626
8 SASI_Mm01_00031201 predicted 431
9 SASI_Mm01_00031202 predicted 518
10 SASI_Mm02_00327931 predicted 446
11 SASI_Mm01_00031194 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015950
VALIDATED
MRPL2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-419s1c1
Sequence:CCGGGCCACAAGCAACGTTATCGAACTCGAGTTCGATAACGTTGCTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-874s1c1
Sequence:CCGGGATCATAACAAACGGGTCATTCTCGAGAATGACCCGTTTGTTATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015950.3-767s21c1
Sequence:CCGGTGCTACTGCGGAAGGTGAATGCTCGAGCATTCACCTTCCGCAGTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015950.3-499s21c1
Sequence:CCGGGTTATCCAAGTCCGCTATGATCTCGAGATCATAGCGGACTTGGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015950.3-1040s21c1
Sequence:CCGGGATATCCCTGTACTCTAATAACTCGAGTTATTAGAGTACAGGGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-324s1c1
Sequence:CCGGGAGTCGTACCAAGTACACCATCTCGAGATGGTGTACTTGGTACGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-835s1c1
Sequence:CCGGGAAACGTGCGTAGCAACAGTACTCGAGTACTGTTGCTACGCACGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015950.3-280s1c1
Sequence:CCGGGTTCTTACTTCTGTGGCCCTTCTCGAGAAGGGCCACAGAAGTAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015950
VALIDATED
MRPL2 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-419s1c1
Sequence:CCGGGCCACAAGCAACGTTATCGAACTCGAGTTCGATAACGTTGCTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-874s1c1
Sequence:CCGGGATCATAACAAACGGGTCATTCTCGAGAATGACCCGTTTGTTATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015950.3-767s21c1
Sequence:CCGGTGCTACTGCGGAAGGTGAATGCTCGAGCATTCACCTTCCGCAGTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015950.3-499s21c1
Sequence:CCGGGTTATCCAAGTCCGCTATGATCTCGAGATCATAGCGGACTTGGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015950.3-1040s21c1
Sequence:CCGGGATATCCCTGTACTCTAATAACTCGAGTTATTAGAGTACAGGGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-324s1c1
Sequence:CCGGGAGTCGTACCAAGTACACCATCTCGAGATGGTGTACTTGGTACGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-835s1c1
Sequence:CCGGGAAACGTGCGTAGCAACAGTACTCGAGTACTGTTGCTACGCACGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015950.3-280s1c1
Sequence:CCGGGTTCTTACTTCTGTGGCCCTTCTCGAGAAGGGCCACAGAAGTAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015950
VALIDATED
MRPL2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-419s1c1
Sequence:CCGGGCCACAAGCAACGTTATCGAACTCGAGTTCGATAACGTTGCTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-874s1c1
Sequence:CCGGGATCATAACAAACGGGTCATTCTCGAGAATGACCCGTTTGTTATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015950.3-767s21c1
Sequence:CCGGTGCTACTGCGGAAGGTGAATGCTCGAGCATTCACCTTCCGCAGTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015950.3-499s21c1
Sequence:CCGGGTTATCCAAGTCCGCTATGATCTCGAGATCATAGCGGACTTGGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015950.3-1040s21c1
Sequence:CCGGGATATCCCTGTACTCTAATAACTCGAGTTATTAGAGTACAGGGATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-324s1c1
Sequence:CCGGGAGTCGTACCAAGTACACCATCTCGAGATGGTGTACTTGGTACGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015950.3-835s1c1
Sequence:CCGGGAAACGTGCGTAGCAACAGTACTCGAGTACTGTTGCTACGCACGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015950.3-280s1c1
Sequence:CCGGGTTCTTACTTCTGTGGCCCTTCTCGAGAAGGGCCACAGAAGTAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025302
VALIDATED
MRPL2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025302.2-272s1c1
Sequence:CCGGCACAGTTAAACCAGTGAAGATCTCGAGATCTTCACTGGTTTAACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-795s1c1
Sequence:CCGGCGAGTATCCAACGTTAACCATCTCGAGATGGTTAACGTTGGATACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-269s1c1
Sequence:CCGGGTACACAGTTAAACCAGTGAACTCGAGTTCACTGGTTTAACTGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-353s1c1
Sequence:CCGGCCACAAACAGAATTATCGCATCTCGAGATGCGATAATTCTGTTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-505s1c1
Sequence:CCGGGCTGGATCATTGCCACGGAAACTCGAGTTTCCGTGGCAATGATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025302
VALIDATED
MRPL2 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025302.2-272s1c1
Sequence:CCGGCACAGTTAAACCAGTGAAGATCTCGAGATCTTCACTGGTTTAACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-795s1c1
Sequence:CCGGCGAGTATCCAACGTTAACCATCTCGAGATGGTTAACGTTGGATACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-269s1c1
Sequence:CCGGGTACACAGTTAAACCAGTGAACTCGAGTTCACTGGTTTAACTGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-353s1c1
Sequence:CCGGCCACAAACAGAATTATCGCATCTCGAGATGCGATAATTCTGTTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-505s1c1
Sequence:CCGGGCTGGATCATTGCCACGGAAACTCGAGTTTCCGTGGCAATGATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025302
VALIDATED
MRPL2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025302.2-272s1c1
Sequence:CCGGCACAGTTAAACCAGTGAAGATCTCGAGATCTTCACTGGTTTAACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-795s1c1
Sequence:CCGGCGAGTATCCAACGTTAACCATCTCGAGATGGTTAACGTTGGATACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-269s1c1
Sequence:CCGGGTACACAGTTAAACCAGTGAACTCGAGTTCACTGGTTTAACTGTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-353s1c1
Sequence:CCGGCCACAAACAGAATTATCGCATCTCGAGATGCGATAATTCTGTTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025302.2-505s1c1
Sequence:CCGGGCTGGATCATTGCCACGGAAACTCGAGTTTCCGTGGCAATGATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)