EMAIL THIS PAGE TO A FRIEND

MRPL30

mitochondrial ribosomal protein L30

115 Gene Product Result for
Synonyms: L28MT L30MT MRP-L28 MRP-L30 MRPL28 MRPL28M RPML28
Gene ID:
Human(51263) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Alternative splicing results in multiple transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 6p and 12p. Read-through transcription also exists between this gene and the neighboring upstream lipoyltransferase 1 (LIPT1) gene. [provided by RefSeq, Mar 2011]
Mouse(107734) mitochondrial ribosomal protein L30
Rat(301352) mitochondrial ribosomal protein L30
sheep(101107082) mitochondrial ribosomal protein L30
domestic guinea pig(100719048) mitochondrial ribosomal protein L30
naked mole-rat(101697819) mitochondrial ribosomal protein L30
Zebrafish(553799) mitochondrial ribosomal protein L30
cow(614151) mitochondrial ribosomal protein L30
domestic cat(101087148) mitochondrial ribosomal protein L30
dog(474558) mitochondrial ribosomal protein L30
fruit fly(31398) mitochondrial ribosomal protein L30
chicken(418699) mitochondrial ribosomal protein L30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145212 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145212 Rosetta Predictions human pricing
NM_145213 Rosetta Predictions human pricing
NM_001106903 Rosetta Predictions rat pricing
NM_027098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225095 predicted 203
2 SASI_Hs01_00225096 predicted 245
3 SASI_Hs01_00225097 predicted 333
4 SASI_Hs01_00225098 predicted 222
5 SASI_Hs01_00225099 predicted 255
6 SASI_Hs01_00225100 predicted 357
7 SASI_Hs01_00225101 predicted 225
8 SASI_Hs01_00225102 predicted 204
9 SASI_Hs01_00225103 predicted 445
10 SASI_Hs02_00365059 predicted 1049
11 SASI_Hs01_00225104 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037239 predicted 195
2 SASI_Hs01_00037240 predicted 940
3 SASI_Hs01_00037241 predicted 245
4 SASI_Hs01_00037242 predicted 329
5 SASI_Hs01_00037243 predicted 223
6 SASI_Hs01_00037244 predicted 258
7 SASI_Hs01_00037245 predicted 348
8 SASI_Hs01_00037246 predicted 224
9 SASI_Hs01_00037247 predicted 196
10 SASI_Hs01_00037248 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223536 predicted 800
2 SASI_Rn02_00223537 predicted 269
3 SASI_Rn02_00223538 predicted 683
4 SASI_Rn02_00223539 predicted 696
5 SASI_Rn02_00223540 predicted 735
6 SASI_Rn02_00223541 predicted 854
7 SASI_Rn02_00223542 predicted 830
8 SASI_Rn02_00223543 predicted 628
9 SASI_Rn02_00223544 predicted 819
10 SASI_Rn02_00223545 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085235 predicted 199
2 SASI_Mm02_00331527 predicted 327
3 SASI_Mm02_00331528 predicted 209
4 SASI_Mm02_00331529 predicted 202
5 SASI_Mm02_00331530 predicted 203
6 SASI_Mm02_00331531 predicted 214
7 SASI_Mm02_00331532 predicted 213
8 SASI_Mm02_00331533 predicted 330
9 SASI_Mm02_00331534 predicted 441
10 SASI_Mm02_00331535 predicted 173
11 SASI_Mm01_00085234 predicted 223
12 SASI_Mm01_00085236 predicted 397
13 SASI_Mm01_00085237 predicted 285
14 SASI_Mm01_00085238 predicted 326
15 SASI_Mm01_00085239 predicted 464
16 SASI_Mm01_00085240 predicted 244
17 SASI_Mm01_00085241 predicted 254
18 SASI_Mm01_00085242 predicted 476
19 SASI_Mm01_00085243 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027098
VALIDATED
MRPL30 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L30
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-325s21c1
Sequence:CCGGCCCTCACAAACTGCACATTGTCTCGAGACAATGTGCAGTTTGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-326s1c1
Sequence:CCGGCCCTCACAAACTGCACATTGTCTCGAGACAATGTGCAGTTTGTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-358s1c1
Sequence:CCGGGAAGTACAAAGAGGCGTCCATCTCGAGATGGACGCCTCTTTGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027098.1-428s1c1
Sequence:CCGGCCCTCAAATTCACAAGAACATCTCGAGATGTTCTTGTGAATTTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027098.1-336s1c1
Sequence:CCGGCTGCACATTGTCACAAGAATACTCGAGTATTCTTGTGACAATGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-466s21c1
Sequence:CCGGGCTGAAAGTGGTTAAACACTTCTCGAGAAGTGTTTAACCACTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-178s21c1
Sequence:CCGGATGCAGACTGCAGACTGTGAACTCGAGTTCACAGTCTGCAGTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-357s21c1
Sequence:CCGGGAAGTACAAAGAGGCGTCCATCTCGAGATGGACGCCTCTTTGTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-467s1c1
Sequence:CCGGGCTGAAAGTGGTTAAACACTTCTCGAGAAGTGTTTAACCACTTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-462s1c1
Sequence:CCGGGCAAAGCTGAAAGTGGTTAAACTCGAGTTTAACCACTTTCAGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027098
VALIDATED
MRPL30 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L30
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-325s21c1
Sequence:CCGGCCCTCACAAACTGCACATTGTCTCGAGACAATGTGCAGTTTGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-326s1c1
Sequence:CCGGCCCTCACAAACTGCACATTGTCTCGAGACAATGTGCAGTTTGTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-358s1c1
Sequence:CCGGGAAGTACAAAGAGGCGTCCATCTCGAGATGGACGCCTCTTTGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027098.1-428s1c1
Sequence:CCGGCCCTCAAATTCACAAGAACATCTCGAGATGTTCTTGTGAATTTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027098.1-336s1c1
Sequence:CCGGCTGCACATTGTCACAAGAATACTCGAGTATTCTTGTGACAATGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-466s21c1
Sequence:CCGGGCTGAAAGTGGTTAAACACTTCTCGAGAAGTGTTTAACCACTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-178s21c1
Sequence:CCGGATGCAGACTGCAGACTGTGAACTCGAGTTCACAGTCTGCAGTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-357s21c1
Sequence:CCGGGAAGTACAAAGAGGCGTCCATCTCGAGATGGACGCCTCTTTGTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-467s1c1
Sequence:CCGGGCTGAAAGTGGTTAAACACTTCTCGAGAAGTGTTTAACCACTTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-462s1c1
Sequence:CCGGGCAAAGCTGAAAGTGGTTAAACTCGAGTTTAACCACTTTCAGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027098
VALIDATED
MRPL30 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L30
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-325s21c1
Sequence:CCGGCCCTCACAAACTGCACATTGTCTCGAGACAATGTGCAGTTTGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-326s1c1
Sequence:CCGGCCCTCACAAACTGCACATTGTCTCGAGACAATGTGCAGTTTGTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-358s1c1
Sequence:CCGGGAAGTACAAAGAGGCGTCCATCTCGAGATGGACGCCTCTTTGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027098.1-428s1c1
Sequence:CCGGCCCTCAAATTCACAAGAACATCTCGAGATGTTCTTGTGAATTTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027098.1-336s1c1
Sequence:CCGGCTGCACATTGTCACAAGAATACTCGAGTATTCTTGTGACAATGTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-466s21c1
Sequence:CCGGGCTGAAAGTGGTTAAACACTTCTCGAGAAGTGTTTAACCACTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-178s21c1
Sequence:CCGGATGCAGACTGCAGACTGTGAACTCGAGTTCACAGTCTGCAGTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027098.2-357s21c1
Sequence:CCGGGAAGTACAAAGAGGCGTCCATCTCGAGATGGACGCCTCTTTGTACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-467s1c1
Sequence:CCGGGCTGAAAGTGGTTAAACACTTCTCGAGAAGTGTTTAACCACTTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027098.1-462s1c1
Sequence:CCGGGCAAAGCTGAAAGTGGTTAAACTCGAGTTTAACCACTTTCAGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016503
MRPL30 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L30
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-345s1c1
Sequence:CCGGGAACCCTCATAAACTGCATATCTCGAGATATGCAGTTTATGAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-337s1c1
Sequence:CCGGGATCCACAGAACCCTCATAAACTCGAGTTTATGAGGGTTCTGTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-204s1c1
Sequence:CCGGCAGACTACAGACTGTGACAAACTCGAGTTTGTCACAGTCTGTAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-203s1c1
Sequence:CCGGGCAGACTACAGACTGTGACAACTCGAGTTGTCACAGTCTGTAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-389s1c1
Sequence:CCGGGAAGACGTCCATATTGGGAAACTCGAGTTTCCCAATATGGACGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-383s1c1
Sequence:CCGGGTACAAGAAGACGTCCATATTCTCGAGAATATGGACGTCTTCTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016503
MRPL30 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L30
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-345s1c1
Sequence:CCGGGAACCCTCATAAACTGCATATCTCGAGATATGCAGTTTATGAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-337s1c1
Sequence:CCGGGATCCACAGAACCCTCATAAACTCGAGTTTATGAGGGTTCTGTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-204s1c1
Sequence:CCGGCAGACTACAGACTGTGACAAACTCGAGTTTGTCACAGTCTGTAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-203s1c1
Sequence:CCGGGCAGACTACAGACTGTGACAACTCGAGTTGTCACAGTCTGTAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-389s1c1
Sequence:CCGGGAAGACGTCCATATTGGGAAACTCGAGTTTCCCAATATGGACGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-383s1c1
Sequence:CCGGGTACAAGAAGACGTCCATATTCTCGAGAATATGGACGTCTTCTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016503
MRPL30 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L30
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-345s1c1
Sequence:CCGGGAACCCTCATAAACTGCATATCTCGAGATATGCAGTTTATGAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-337s1c1
Sequence:CCGGGATCCACAGAACCCTCATAAACTCGAGTTTATGAGGGTTCTGTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-204s1c1
Sequence:CCGGCAGACTACAGACTGTGACAAACTCGAGTTTGTCACAGTCTGTAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-203s1c1
Sequence:CCGGGCAGACTACAGACTGTGACAACTCGAGTTGTCACAGTCTGTAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-389s1c1
Sequence:CCGGGAAGACGTCCATATTGGGAAACTCGAGTTTCCCAATATGGACGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016503.2-383s1c1
Sequence:CCGGGTACAAGAAGACGTCCATATTCTCGAGAATATGGACGTCTTCTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145212
VALIDATED
MRPL30 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L30
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145212.2-1716s21c1
Sequence:CCGGCTGGATGCCAGCTAGATTATCCTCGAGGATAATCTAGCTGGCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145212.2-630s21c1
Sequence:CCGGGAAAGCACATGAGTCCTAATGCTCGAGCATTAGGACTCATGTGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_145212.2-225s21c1
Sequence:CCGGAGGTGTGGAGTCTCTTATTTGCTCGAGCAAATAAGAGACTCCACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_145212.2-336s21c1
Sequence:CCGGGGATCCACAGAACCCTCATAACTCGAGTTATGAGGGTTCTGTGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145212.2-383s21c1
Sequence:CCGGGTACAAGAAGACGTCCATATTCTCGAGAATATGGACGTCTTCTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145212
VALIDATED
MRPL30 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L30
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145212.2-1716s21c1
Sequence:CCGGCTGGATGCCAGCTAGATTATCCTCGAGGATAATCTAGCTGGCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145212.2-630s21c1
Sequence:CCGGGAAAGCACATGAGTCCTAATGCTCGAGCATTAGGACTCATGTGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_145212.2-225s21c1
Sequence:CCGGAGGTGTGGAGTCTCTTATTTGCTCGAGCAAATAAGAGACTCCACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_145212.2-336s21c1
Sequence:CCGGGGATCCACAGAACCCTCATAACTCGAGTTATGAGGGTTCTGTGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145212.2-383s21c1
Sequence:CCGGGTACAAGAAGACGTCCATATTCTCGAGAATATGGACGTCTTCTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145212
VALIDATED
MRPL30 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L30
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145212.2-1716s21c1
Sequence:CCGGCTGGATGCCAGCTAGATTATCCTCGAGGATAATCTAGCTGGCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145212.2-630s21c1
Sequence:CCGGGAAAGCACATGAGTCCTAATGCTCGAGCATTAGGACTCATGTGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_145212.2-225s21c1
Sequence:CCGGAGGTGTGGAGTCTCTTATTTGCTCGAGCAAATAAGAGACTCCACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_145212.2-336s21c1
Sequence:CCGGGGATCCACAGAACCCTCATAACTCGAGTTATGAGGGTTCTGTGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145212.2-383s21c1
Sequence:CCGGGTACAAGAAGACGTCCATATTCTCGAGAATATGGACGTCTTCTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)