EMAIL THIS PAGE TO A FRIEND

MRPL32

mitochondrial ribosomal protein L32

47 Gene Product Result for
Synonyms: L32mt MRP-L32 bMRP-59b
UniProtKB ID: Q9BYC8, Q96Q68, Q9P098
Gene ID:
Human(64983) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L32 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome Xp. [provided by RefSeq, Jul 2008]
Mouse(75398) mitochondrial ribosomal protein L32
Rat(291206) mitochondrial ribosomal protein L32
Zebrafish(751730) mitochondrial ribosomal protein L32
cow(532842) mitochondrial ribosomal protein L32
domestic cat(101087979) mitochondrial ribosomal protein L32
dog(475869) mitochondrial ribosomal protein L32
chicken(420773) mitochondrial ribosomal protein L32
fruit fly(43698) mitochondrial ribosomal protein L32
naked mole-rat(101702369) mitochondrial ribosomal protein L32
domestic guinea pig(100720066) mitochondrial ribosomal protein L32
sheep(100305129) mitochondrial ribosomal protein L32
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091351 MISSION® esiRNA esiRNA targeting mouse Mrpl32 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031903 Rosetta Predictions human pricing
NM_001106116 Rosetta Predictions rat pricing
NM_029271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216433 predicted 590
2 SASI_Hs02_00359026 predicted 583
3 SASI_Hs01_00216434 predicted 330
4 SASI_Hs01_00216436 predicted 358
5 SASI_Hs01_00216439 predicted 525
6 SASI_Hs01_00216440 predicted 371
7 SASI_Hs02_00359027 predicted 404
8 SASI_Hs01_00216442 predicted 434
9 SASI_Hs02_00359028 predicted 306
10 SASI_Hs02_00359029 predicted 303
11 SASI_Hs01_00216435 predicted 514
12 SASI_Hs01_00216437 predicted 402
13 SASI_Hs01_00216438 predicted 369
14 SASI_Hs01_00216441 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215778 predicted 509
2 SASI_Rn02_00215779 predicted 412
3 SASI_Rn02_00215780 predicted 394
4 SASI_Rn02_00215781 predicted 391
5 SASI_Rn02_00215782 predicted 496
6 SASI_Rn02_00215783 predicted 393
7 SASI_Rn02_00215784 predicted 471
8 SASI_Rn02_00215785 predicted 416
9 SASI_Rn02_00215786 predicted 513
10 SASI_Rn02_00215787 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058258 predicted 370
2 SASI_Mm01_00058259 predicted 373
3 SASI_Mm01_00058260 predicted 371
4 SASI_Mm01_00058262 predicted 458
5 SASI_Mm01_00058261 predicted 449
6 SASI_Mm01_00058263 predicted 448
7 SASI_Mm01_00058264 predicted 159
8 SASI_Mm01_00058265 predicted 162
9 SASI_Mm01_00058266 predicted 190
10 SASI_Mm01_00058267 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031903
VALIDATED
MRPL32 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L32
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-411s21c1
Sequence:CCGGCTTTGTGCCTACTGCTATGAACTCGAGTTCATAGCAGTAGGCACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-450s21c1
Sequence:CCGGGCAGAAATCAGACGACAGATACTCGAGTATCTGTCGTCTGATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-336s21c1
Sequence:CCGGCCGCAGAAGCTTATTAAAGTTCTCGAGAACTTTAATAAGCTTCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-534s21c1
Sequence:CCGGGAGACACCGTCTGAACAAGATCTCGAGATCTTGTTCAGACGGTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031903.1-533s1c1
Sequence:CCGGGAGACACCGTCTGAACAAGATCTCGAGATCTTGTTCAGACGGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031903.1-449s1c1
Sequence:CCGGGCAGAAATCAGACGACAGATACTCGAGTATCTGTCGTCTGATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031903.1-219s1c1
Sequence:CCGGCAGCAAATGATACCAGTGGAACTCGAGTTCCACTGGTATCATTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031903.1-410s1c1
Sequence:CCGGCTTTGTGCCTACTGCTATGAACTCGAGTTCATAGCAGTAGGCACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031903.1-565s1c1
Sequence:CCGGGATCATTGAACGAGACAGAAACTCGAGTTTCTGTCTCGTTCAATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031903.1-335s1c1
Sequence:CCGGCCGCAGAAGCTTATTAAAGTTCTCGAGAACTTTAATAAGCTTCTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146569    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031903.1-657s1c1
Sequence:CCGGCCTGAAATAGAGGAAGATTCTCTCGAGAGAATCTTCCTCTATTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031903
VALIDATED
MRPL32 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L32
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-411s21c1
Sequence:CCGGCTTTGTGCCTACTGCTATGAACTCGAGTTCATAGCAGTAGGCACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-450s21c1
Sequence:CCGGGCAGAAATCAGACGACAGATACTCGAGTATCTGTCGTCTGATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-336s21c1
Sequence:CCGGCCGCAGAAGCTTATTAAAGTTCTCGAGAACTTTAATAAGCTTCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-534s21c1
Sequence:CCGGGAGACACCGTCTGAACAAGATCTCGAGATCTTGTTCAGACGGTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031903.1-533s1c1
Sequence:CCGGGAGACACCGTCTGAACAAGATCTCGAGATCTTGTTCAGACGGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031903.1-449s1c1
Sequence:CCGGGCAGAAATCAGACGACAGATACTCGAGTATCTGTCGTCTGATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031903.1-219s1c1
Sequence:CCGGCAGCAAATGATACCAGTGGAACTCGAGTTCCACTGGTATCATTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031903.1-410s1c1
Sequence:CCGGCTTTGTGCCTACTGCTATGAACTCGAGTTCATAGCAGTAGGCACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031903.1-565s1c1
Sequence:CCGGGATCATTGAACGAGACAGAAACTCGAGTTTCTGTCTCGTTCAATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031903.1-335s1c1
Sequence:CCGGCCGCAGAAGCTTATTAAAGTTCTCGAGAACTTTAATAAGCTTCTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146569    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031903.1-657s1c1
Sequence:CCGGCCTGAAATAGAGGAAGATTCTCTCGAGAGAATCTTCCTCTATTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031903
VALIDATED
MRPL32 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L32
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-411s21c1
Sequence:CCGGCTTTGTGCCTACTGCTATGAACTCGAGTTCATAGCAGTAGGCACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-450s21c1
Sequence:CCGGGCAGAAATCAGACGACAGATACTCGAGTATCTGTCGTCTGATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-336s21c1
Sequence:CCGGCCGCAGAAGCTTATTAAAGTTCTCGAGAACTTTAATAAGCTTCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031903.2-534s21c1
Sequence:CCGGGAGACACCGTCTGAACAAGATCTCGAGATCTTGTTCAGACGGTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031903.1-533s1c1
Sequence:CCGGGAGACACCGTCTGAACAAGATCTCGAGATCTTGTTCAGACGGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031903.1-449s1c1
Sequence:CCGGGCAGAAATCAGACGACAGATACTCGAGTATCTGTCGTCTGATTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031903.1-219s1c1
Sequence:CCGGCAGCAAATGATACCAGTGGAACTCGAGTTCCACTGGTATCATTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031903.1-410s1c1
Sequence:CCGGCTTTGTGCCTACTGCTATGAACTCGAGTTCATAGCAGTAGGCACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031903.1-565s1c1
Sequence:CCGGGATCATTGAACGAGACAGAAACTCGAGTTTCTGTCTCGTTCAATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031903.1-335s1c1
Sequence:CCGGCCGCAGAAGCTTATTAAAGTTCTCGAGAACTTTAATAAGCTTCTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146569    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031903.1-657s1c1
Sequence:CCGGCCTGAAATAGAGGAAGATTCTCTCGAGAGAATCTTCCTCTATTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029271
VALIDATED
MRPL32 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L32
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.2-384s1c1
Sequence:CCGGGTGGATATTGCTATGAGAAAGCTCGAGCTTTCTCATAGCAATATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.2-564s1c1
Sequence:CCGGCTTGGTTCACCCAGAATTGAACTCGAGTTCAATTCTGGGTGAACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-373s21c1
Sequence:CCGGACATGTCCTTTGTGGATATTGCTCGAGCAATATCCACAAAGGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-467s21c1
Sequence:CCGGGCTCCTTCCGTTGAGACTATGCTCGAGCATAGTCTCAACGGAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-602s21c1
Sequence:CCGGGATAATTTCATAGTTAGGCACCTCGAGGTGCCTAACTATGAAATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-528s21c1
Sequence:CCGGGCAAGAGGATTGTTGAAAGAACTCGAGTTCTTTCAACAATCCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-265s21c1
Sequence:CCGGCAGACGCACCATCGAAGTTAACTCGAGTTAACTTCGATGGTGCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.1-476s1c1
Sequence:CCGGCGTTGAGACTATGGTGCTGTACTCGAGTACAGCACCATAGTCTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029271.1-266s1c1
Sequence:CCGGCAGACGCACCATCGAAGTTAACTCGAGTTAACTTCGATGGTGCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029271.1-529s1c1
Sequence:CCGGGCAAGAGGATTGTTGAAAGAACTCGAGTTCTTTCAACAATCCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029271.1-603s1c1
Sequence:CCGGGATAATTTCATAGTTAGGCACCTCGAGGTGCCTAACTATGAAATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.1-274s1c1
Sequence:CCGGCCATCGAAGTTAACCGATGTACTCGAGTACATCGGTTAACTTCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029271.1-499s1c1
Sequence:CCGGCAGGAGAGAAACCATCAGAAACTCGAGTTTCTGATGGTTTCTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029271
VALIDATED
MRPL32 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L32
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.2-384s1c1
Sequence:CCGGGTGGATATTGCTATGAGAAAGCTCGAGCTTTCTCATAGCAATATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.2-564s1c1
Sequence:CCGGCTTGGTTCACCCAGAATTGAACTCGAGTTCAATTCTGGGTGAACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-373s21c1
Sequence:CCGGACATGTCCTTTGTGGATATTGCTCGAGCAATATCCACAAAGGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-467s21c1
Sequence:CCGGGCTCCTTCCGTTGAGACTATGCTCGAGCATAGTCTCAACGGAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-602s21c1
Sequence:CCGGGATAATTTCATAGTTAGGCACCTCGAGGTGCCTAACTATGAAATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-528s21c1
Sequence:CCGGGCAAGAGGATTGTTGAAAGAACTCGAGTTCTTTCAACAATCCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-265s21c1
Sequence:CCGGCAGACGCACCATCGAAGTTAACTCGAGTTAACTTCGATGGTGCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.1-476s1c1
Sequence:CCGGCGTTGAGACTATGGTGCTGTACTCGAGTACAGCACCATAGTCTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029271.1-266s1c1
Sequence:CCGGCAGACGCACCATCGAAGTTAACTCGAGTTAACTTCGATGGTGCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029271.1-529s1c1
Sequence:CCGGGCAAGAGGATTGTTGAAAGAACTCGAGTTCTTTCAACAATCCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029271.1-603s1c1
Sequence:CCGGGATAATTTCATAGTTAGGCACCTCGAGGTGCCTAACTATGAAATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.1-274s1c1
Sequence:CCGGCCATCGAAGTTAACCGATGTACTCGAGTACATCGGTTAACTTCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029271.1-499s1c1
Sequence:CCGGCAGGAGAGAAACCATCAGAAACTCGAGTTTCTGATGGTTTCTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029271
VALIDATED
MRPL32 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L32
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.2-384s1c1
Sequence:CCGGGTGGATATTGCTATGAGAAAGCTCGAGCTTTCTCATAGCAATATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.2-564s1c1
Sequence:CCGGCTTGGTTCACCCAGAATTGAACTCGAGTTCAATTCTGGGTGAACCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-373s21c1
Sequence:CCGGACATGTCCTTTGTGGATATTGCTCGAGCAATATCCACAAAGGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-467s21c1
Sequence:CCGGGCTCCTTCCGTTGAGACTATGCTCGAGCATAGTCTCAACGGAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-602s21c1
Sequence:CCGGGATAATTTCATAGTTAGGCACCTCGAGGTGCCTAACTATGAAATTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-528s21c1
Sequence:CCGGGCAAGAGGATTGTTGAAAGAACTCGAGTTCTTTCAACAATCCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029271.2-265s21c1
Sequence:CCGGCAGACGCACCATCGAAGTTAACTCGAGTTAACTTCGATGGTGCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.1-476s1c1
Sequence:CCGGCGTTGAGACTATGGTGCTGTACTCGAGTACAGCACCATAGTCTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029271.1-266s1c1
Sequence:CCGGCAGACGCACCATCGAAGTTAACTCGAGTTAACTTCGATGGTGCGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029271.1-529s1c1
Sequence:CCGGGCAAGAGGATTGTTGAAAGAACTCGAGTTCTTTCAACAATCCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029271.1-603s1c1
Sequence:CCGGGATAATTTCATAGTTAGGCACCTCGAGGTGCCTAACTATGAAATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029271.1-274s1c1
Sequence:CCGGCCATCGAAGTTAACCGATGTACTCGAGTACATCGGTTAACTTCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029271.1-499s1c1
Sequence:CCGGCAGGAGAGAAACCATCAGAAACTCGAGTTTCTGATGGTTTCTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)