EMAIL THIS PAGE TO A FRIEND

MRPL33

mitochondrial ribosomal protein L33

76 Gene Product Result for
Synonyms: C2orf1 L33mt MRP-L33 RPL33L
UniProtKB ID: O75394, Q53RZ6, Q5FVE3, Q96Q50
Gene ID:
Human(9553) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(66845) mitochondrial ribosomal protein L33
Rat(100363539) mitochondrial ribosomal protein L33
fruit fly(50381) mitochondrial ribosomal protein L33
domestic cat(101094587) mitochondrial ribosomal protein L33
cow(614711) mitochondrial ribosomal protein L33
dog(611180) mitochondrial ribosomal protein L33
chicken(771953) mitochondrial ribosomal protein L33
sheep(101120734) mitochondrial ribosomal protein L33
domestic guinea pig(100722643) mitochondrial ribosomal protein L33
naked mole-rat(101724495) mitochondrial ribosomal protein L33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004891 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004891 Rosetta Predictions human pricing
NM_145330 Rosetta Predictions human pricing
NM_025796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225735 predicted 217
2 SASI_Hs01_00225736 predicted 248
3 SASI_Hs01_00225737 predicted 246
4 SASI_Hs01_00225738 predicted 242
5 SASI_Hs01_00225739 predicted 247
6 SASI_Hs01_00225740 predicted 248
7 SASI_Hs01_00225741 predicted 249
8 SASI_Hs01_00225742 predicted 143
9 SASI_Hs01_00225743 predicted 130
10 SASI_Hs01_00225744 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025957 predicted 329
2 SASI_Hs02_00365224 predicted 302
3 SASI_Hs01_00025960 predicted 335
4 SASI_Hs01_00025961 predicted 329
5 SASI_Hs01_00025962 predicted 310
6 SASI_Hs01_00025963 predicted 326
7 SASI_Hs01_00025964 predicted 235
8 SASI_Hs01_00025966 predicted 329
9 SASI_Hs02_00365225 predicted 309
10 SASI_Hs02_00365226 predicted 247
11 SASI_Hs01_00025958 predicted 342
12 SASI_Hs01_00025959 predicted 91
13 SASI_Hs01_00025965 predicted 86
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050253 predicted 212
2 SASI_Mm01_00050254 predicted 214
3 SASI_Mm01_00050255 predicted 212
4 SASI_Mm01_00050256 predicted 211
5 SASI_Mm01_00050257 predicted 217
6 SASI_Mm01_00050258 predicted 211
7 SASI_Mm01_00050259 predicted 242
8 SASI_Mm01_00050260 predicted 72
9 SASI_Mm01_00050261 predicted 399
10 SASI_Mm01_00050262 predicted 161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025796
VALIDATED
MRPL33 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L33
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-256s1c1
Sequence:CCGGCTAAATGAGAAGCTCGAGGGTCTCGAGACCCTCGAGCTTCTCATTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-151s1c1
Sequence:CCGGCTGAGCCTTCTGCACTATGATCTCGAGATCATAGTGCAGAAGGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-105s1c1
Sequence:CCGGGACAGGTTTCTCCTTCAACCACTCGAGTGGTTGAAGGAGAAACCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-79s1c1
Sequence:CCGGCTGGTGAAACTAGTGAGCCAACTCGAGTTGGCTCACTAGTTTCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025796.1-162s1c1
Sequence:CCGGGCACTATGATCCAATAGTGAACTCGAGTTCACTATTGGATCATAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-243s21c1
Sequence:CCGGTGAATTTGATTCCTAAATGAGCTCGAGCTCATTTAGGAATCAAATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-150s21c1
Sequence:CCGGCTGAGCCTTCTGCACTATGATCTCGAGATCATAGTGCAGAAGGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-104s21c1
Sequence:CCGGGACAGGTTTCTCCTTCAACCACTCGAGTGGTTGAAGGAGAAACCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-218s21c1
Sequence:CCGGTTCCCTCTGAGTAGTGGATTGCTCGAGCAATCCACTACTCAGAGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-188s21c1
Sequence:CCGGAGTTCTCTTTGTGGGACAGAACTCGAGTTCTGTCCCACAAAGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025796
VALIDATED
MRPL33 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L33
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-256s1c1
Sequence:CCGGCTAAATGAGAAGCTCGAGGGTCTCGAGACCCTCGAGCTTCTCATTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-151s1c1
Sequence:CCGGCTGAGCCTTCTGCACTATGATCTCGAGATCATAGTGCAGAAGGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-105s1c1
Sequence:CCGGGACAGGTTTCTCCTTCAACCACTCGAGTGGTTGAAGGAGAAACCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-79s1c1
Sequence:CCGGCTGGTGAAACTAGTGAGCCAACTCGAGTTGGCTCACTAGTTTCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025796.1-162s1c1
Sequence:CCGGGCACTATGATCCAATAGTGAACTCGAGTTCACTATTGGATCATAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-243s21c1
Sequence:CCGGTGAATTTGATTCCTAAATGAGCTCGAGCTCATTTAGGAATCAAATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-150s21c1
Sequence:CCGGCTGAGCCTTCTGCACTATGATCTCGAGATCATAGTGCAGAAGGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-104s21c1
Sequence:CCGGGACAGGTTTCTCCTTCAACCACTCGAGTGGTTGAAGGAGAAACCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-218s21c1
Sequence:CCGGTTCCCTCTGAGTAGTGGATTGCTCGAGCAATCCACTACTCAGAGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-188s21c1
Sequence:CCGGAGTTCTCTTTGTGGGACAGAACTCGAGTTCTGTCCCACAAAGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025796
VALIDATED
MRPL33 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L33
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-256s1c1
Sequence:CCGGCTAAATGAGAAGCTCGAGGGTCTCGAGACCCTCGAGCTTCTCATTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-151s1c1
Sequence:CCGGCTGAGCCTTCTGCACTATGATCTCGAGATCATAGTGCAGAAGGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-105s1c1
Sequence:CCGGGACAGGTTTCTCCTTCAACCACTCGAGTGGTTGAAGGAGAAACCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025796.1-79s1c1
Sequence:CCGGCTGGTGAAACTAGTGAGCCAACTCGAGTTGGCTCACTAGTTTCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025796.1-162s1c1
Sequence:CCGGGCACTATGATCCAATAGTGAACTCGAGTTCACTATTGGATCATAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-243s21c1
Sequence:CCGGTGAATTTGATTCCTAAATGAGCTCGAGCTCATTTAGGAATCAAATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-150s21c1
Sequence:CCGGCTGAGCCTTCTGCACTATGATCTCGAGATCATAGTGCAGAAGGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-104s21c1
Sequence:CCGGGACAGGTTTCTCCTTCAACCACTCGAGTGGTTGAAGGAGAAACCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-218s21c1
Sequence:CCGGTTCCCTCTGAGTAGTGGATTGCTCGAGCAATCCACTACTCAGAGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025796.2-188s21c1
Sequence:CCGGAGTTCTCTTTGTGGGACAGAACTCGAGTTCTGTCCCACAAAGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004891
VALIDATED
MRPL33 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L33
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004891.2-198s1c1
Sequence:CCGGGATCCAGTTGTGAAACAAAGACTCGAGTCTTTGTTTCACAACTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004891.2-191s1c1
Sequence:CCGGGCATTATGATCCAGTTGTGAACTCGAGTTCACAACTGGATCATAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004891.2-320s1c1
Sequence:CCGGGAAATCCTGTAGCGTGTAATACTCGAGTATTACACGCTACAGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-159s21c1
Sequence:CCGGAGAGAAACCGACTGCGGGAAACTCGAGTTTCCCGCAGTCGGTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-195s21c1
Sequence:CCGGATTATGATCCAGTTGTGAAACCTCGAGGTTTCACAACTGGATCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-322s21c1
Sequence:CCGGGAAATCCTGTAGCGTGTAATACTCGAGTATTACACGCTACAGGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-81s21c1
Sequence:CCGGTCTTTGCCAAGAGCAAGTCAACTCGAGTTGACTTGCTCTTGGCAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-250s21c1
Sequence:CCGGCTCCCTTTAAACGGTGGATTGCTCGAGCAATCCACCGTTTAAAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004891
VALIDATED
MRPL33 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L33
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004891.2-198s1c1
Sequence:CCGGGATCCAGTTGTGAAACAAAGACTCGAGTCTTTGTTTCACAACTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004891.2-191s1c1
Sequence:CCGGGCATTATGATCCAGTTGTGAACTCGAGTTCACAACTGGATCATAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004891.2-320s1c1
Sequence:CCGGGAAATCCTGTAGCGTGTAATACTCGAGTATTACACGCTACAGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-159s21c1
Sequence:CCGGAGAGAAACCGACTGCGGGAAACTCGAGTTTCCCGCAGTCGGTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-195s21c1
Sequence:CCGGATTATGATCCAGTTGTGAAACCTCGAGGTTTCACAACTGGATCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-322s21c1
Sequence:CCGGGAAATCCTGTAGCGTGTAATACTCGAGTATTACACGCTACAGGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-81s21c1
Sequence:CCGGTCTTTGCCAAGAGCAAGTCAACTCGAGTTGACTTGCTCTTGGCAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-250s21c1
Sequence:CCGGCTCCCTTTAAACGGTGGATTGCTCGAGCAATCCACCGTTTAAAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004891
VALIDATED
MRPL33 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L33
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004891.2-198s1c1
Sequence:CCGGGATCCAGTTGTGAAACAAAGACTCGAGTCTTTGTTTCACAACTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004891.2-191s1c1
Sequence:CCGGGCATTATGATCCAGTTGTGAACTCGAGTTCACAACTGGATCATAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004891.2-320s1c1
Sequence:CCGGGAAATCCTGTAGCGTGTAATACTCGAGTATTACACGCTACAGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-159s21c1
Sequence:CCGGAGAGAAACCGACTGCGGGAAACTCGAGTTTCCCGCAGTCGGTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-195s21c1
Sequence:CCGGATTATGATCCAGTTGTGAAACCTCGAGGTTTCACAACTGGATCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-322s21c1
Sequence:CCGGGAAATCCTGTAGCGTGTAATACTCGAGTATTACACGCTACAGGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-81s21c1
Sequence:CCGGTCTTTGCCAAGAGCAAGTCAACTCGAGTTGACTTGCTCTTGGCAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004891.3-250s21c1
Sequence:CCGGCTCCCTTTAAACGGTGGATTGCTCGAGCAATCCACCGTTTAAAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)