EMAIL THIS PAGE TO A FRIEND

MRPL34

mitochondrial ribosomal protein L34

52 Gene Product Result for
Synonyms: L34mt
UniProtKB ID: Q9BQ48
Gene ID:
Human(64981) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(94065) mitochondrial ribosomal protein L34
Rat(290632) mitochondrial ribosomal protein L34
naked mole-rat(101720098) mitochondrial ribosomal protein L34
domestic guinea pig(100732453) mitochondrial ribosomal protein L34
sheep(101112812) mitochondrial ribosomal protein L34
Zebrafish(552972) mitochondrial ribosomal protein L34
cow(786454) mitochondrial ribosomal protein L34
domestic cat(101096547) mitochondrial ribosomal protein L34
dog(610139) mitochondrial ribosomal protein L34
chicken(426941) mitochondrial ribosomal protein L34
fruit fly(4379878) mitochondrial ribosomal protein L34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023937 Rosetta Predictions human pricing
NM_001006965 Rosetta Predictions rat pricing
NM_053162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356403 predicted 508
2 SASI_Hs01_00022262 predicted 547
3 SASI_Hs01_00022263 predicted 546
4 SASI_Hs01_00022264 predicted 382
5 SASI_Hs02_00356404 predicted 361
6 SASI_Hs01_00022266 predicted 439
7 SASI_Hs01_00022267 predicted 384
8 SASI_Hs02_00356405 predicted 365
9 SASI_Hs01_00022268 predicted 523
10 SASI_Hs01_00022269 predicted 549
11 SASI_Hs01_00022265 predicted 456
12 SASI_Hs01_00022270 predicted 453
13 SASI_Hs01_00022271 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087212 predicted 318
2 SASI_Rn01_00087213 predicted 305
3 SASI_Rn01_00087214 predicted 275
4 SASI_Rn01_00087215 predicted 295
5 SASI_Rn01_00087216 predicted 303
6 SASI_Rn01_00087217 predicted 307
7 SASI_Rn01_00087218 predicted 298
8 SASI_Rn01_00087219 predicted 235
9 SASI_Rn01_00087220 predicted 293
10 SASI_Rn01_00087221 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073990 predicted 376
2 SASI_Mm02_00337684 predicted 232
3 SASI_Mm02_00337685 predicted 210
4 SASI_Mm02_00337686 predicted 212
5 SASI_Mm02_00337687 predicted 237
6 SASI_Mm01_00073996 predicted 354
7 SASI_Mm01_00073997 predicted 291
8 SASI_Mm02_00337688 predicted 214
9 SASI_Mm01_00073998 predicted 362
10 SASI_Mm02_00337689 predicted 203
11 SASI_Mm01_00073991 predicted 282
12 SASI_Mm01_00073992 predicted 308
13 SASI_Mm01_00073993 predicted 227
14 SASI_Mm01_00073994 predicted 316
15 SASI_Mm01_00073995 predicted 249
16 SASI_Mm01_00073999 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053162
MRPL34 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L34
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-78s1c1
Sequence:CCGGGCCCTATTGAGTGGCAGGTATCTCGAGATACCTGCCACTCAATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-197s1c1
Sequence:CCGGCAACATCAAGCGCAAGCACAACTCGAGTTGTGCTTGCGCTTGATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-185s1c1
Sequence:CCGGGTATCAGCCGAGCAACATCAACTCGAGTTGATGTTGCTCGGCTGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-257s1c1
Sequence:CCGGGCAGGTCATCCTCCGTCGCATCTCGAGATGCGACGGAGGATGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053162.1-327s1c1
Sequence:CCGGGAATAGACTCAGACGCCGGTACTCGAGTACCGGCGTCTGAGTCTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053162.2-438s21c1
Sequence:CCGGGGTCTGTCCCTTCGTAGGTTTCTCGAGAAACCTACGAAGGGACAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053162.2-143s21c1
Sequence:CCGGGTATCTCCAGTCCAGAGTCTGCTCGAGCAGACTCTGGACTGGAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053162.2-475s21c1
Sequence:CCGGTCGACGGCTGCTTACCAACCACTCGAGTGGTTGGTAAGCAGCCGTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053162.2-114s21c1
Sequence:CCGGTGCAGATCGGTGGCCCTATTGCTCGAGCAATAGGGCCACCGATCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053162
MRPL34 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L34
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-78s1c1
Sequence:CCGGGCCCTATTGAGTGGCAGGTATCTCGAGATACCTGCCACTCAATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-197s1c1
Sequence:CCGGCAACATCAAGCGCAAGCACAACTCGAGTTGTGCTTGCGCTTGATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-185s1c1
Sequence:CCGGGTATCAGCCGAGCAACATCAACTCGAGTTGATGTTGCTCGGCTGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-257s1c1
Sequence:CCGGGCAGGTCATCCTCCGTCGCATCTCGAGATGCGACGGAGGATGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053162.1-327s1c1
Sequence:CCGGGAATAGACTCAGACGCCGGTACTCGAGTACCGGCGTCTGAGTCTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053162.2-438s21c1
Sequence:CCGGGGTCTGTCCCTTCGTAGGTTTCTCGAGAAACCTACGAAGGGACAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053162.2-143s21c1
Sequence:CCGGGTATCTCCAGTCCAGAGTCTGCTCGAGCAGACTCTGGACTGGAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053162.2-475s21c1
Sequence:CCGGTCGACGGCTGCTTACCAACCACTCGAGTGGTTGGTAAGCAGCCGTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053162.2-114s21c1
Sequence:CCGGTGCAGATCGGTGGCCCTATTGCTCGAGCAATAGGGCCACCGATCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053162
MRPL34 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L34
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-78s1c1
Sequence:CCGGGCCCTATTGAGTGGCAGGTATCTCGAGATACCTGCCACTCAATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-197s1c1
Sequence:CCGGCAACATCAAGCGCAAGCACAACTCGAGTTGTGCTTGCGCTTGATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-185s1c1
Sequence:CCGGGTATCAGCCGAGCAACATCAACTCGAGTTGATGTTGCTCGGCTGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053162.1-257s1c1
Sequence:CCGGGCAGGTCATCCTCCGTCGCATCTCGAGATGCGACGGAGGATGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053162.1-327s1c1
Sequence:CCGGGAATAGACTCAGACGCCGGTACTCGAGTACCGGCGTCTGAGTCTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053162.2-438s21c1
Sequence:CCGGGGTCTGTCCCTTCGTAGGTTTCTCGAGAAACCTACGAAGGGACAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053162.2-143s21c1
Sequence:CCGGGTATCTCCAGTCCAGAGTCTGCTCGAGCAGACTCTGGACTGGAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053162.2-475s21c1
Sequence:CCGGTCGACGGCTGCTTACCAACCACTCGAGTGGTTGGTAAGCAGCCGTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053162.2-114s21c1
Sequence:CCGGTGCAGATCGGTGGCCCTATTGCTCGAGCAATAGGGCCACCGATCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023937
MRPL34 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L34
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023937.2-392s1c1
Sequence:CCGGGCAACATCAAACGCAAGAACACTCGAGTGTTCTTGCGTTTGATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023937.2-703s1c1
Sequence:CCGGGCAACAGACCAAAGAACAGTACTCGAGTACTGTTCTTTGGTCTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023937.2-815s1c1
Sequence:CCGGCATCGGATTATTTCTTCTGTACTCGAGTACAGAAGAAATAATCCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023937.3-488s21c1
Sequence:CCGGAGTCGCTGAGCCATTGAGGATCTCGAGATCCTCAATGGCTCAGCGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023937.2-814s1c1
Sequence:CCGGGCATCGGATTATTTCTTCTGTCTCGAGACAGAAGAAATAATCCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023937.2-390s1c1
Sequence:CCGGGAGCAACATCAAACGCAAGAACTCGAGTTCTTGCGTTTGATGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023937.2-381s1c1
Sequence:CCGGGTATCAGCCGAGCAACATCAACTCGAGTTGATGTTGCTCGGCTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023937.3-460s21c1
Sequence:CCGGATCCTTCGCCGAATGCTCAAGCTCGAGCTTGAGCATTCGGCGAAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023937.3-678s21c1
Sequence:CCGGTAATTAGGAAGCATTTCGAACCTCGAGGTTCGAAATGCTTCCTAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023937.3-606s21c1
Sequence:CCGGGGACCTGAGTGCTCTCCATATCTCGAGATATGGAGAGCACTCAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023937
MRPL34 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L34
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023937.2-392s1c1
Sequence:CCGGGCAACATCAAACGCAAGAACACTCGAGTGTTCTTGCGTTTGATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023937.2-703s1c1
Sequence:CCGGGCAACAGACCAAAGAACAGTACTCGAGTACTGTTCTTTGGTCTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023937.2-815s1c1
Sequence:CCGGCATCGGATTATTTCTTCTGTACTCGAGTACAGAAGAAATAATCCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023937.3-488s21c1
Sequence:CCGGAGTCGCTGAGCCATTGAGGATCTCGAGATCCTCAATGGCTCAGCGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023937.2-814s1c1
Sequence:CCGGGCATCGGATTATTTCTTCTGTCTCGAGACAGAAGAAATAATCCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023937.2-390s1c1
Sequence:CCGGGAGCAACATCAAACGCAAGAACTCGAGTTCTTGCGTTTGATGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023937.2-381s1c1
Sequence:CCGGGTATCAGCCGAGCAACATCAACTCGAGTTGATGTTGCTCGGCTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023937.3-460s21c1
Sequence:CCGGATCCTTCGCCGAATGCTCAAGCTCGAGCTTGAGCATTCGGCGAAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023937.3-678s21c1
Sequence:CCGGTAATTAGGAAGCATTTCGAACCTCGAGGTTCGAAATGCTTCCTAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023937.3-606s21c1
Sequence:CCGGGGACCTGAGTGCTCTCCATATCTCGAGATATGGAGAGCACTCAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023937
MRPL34 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L34
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023937.2-392s1c1
Sequence:CCGGGCAACATCAAACGCAAGAACACTCGAGTGTTCTTGCGTTTGATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023937.2-703s1c1
Sequence:CCGGGCAACAGACCAAAGAACAGTACTCGAGTACTGTTCTTTGGTCTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023937.2-815s1c1
Sequence:CCGGCATCGGATTATTTCTTCTGTACTCGAGTACAGAAGAAATAATCCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023937.3-488s21c1
Sequence:CCGGAGTCGCTGAGCCATTGAGGATCTCGAGATCCTCAATGGCTCAGCGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023937.2-814s1c1
Sequence:CCGGGCATCGGATTATTTCTTCTGTCTCGAGACAGAAGAAATAATCCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023937.2-390s1c1
Sequence:CCGGGAGCAACATCAAACGCAAGAACTCGAGTTCTTGCGTTTGATGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023937.2-381s1c1
Sequence:CCGGGTATCAGCCGAGCAACATCAACTCGAGTTGATGTTGCTCGGCTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023937.3-460s21c1
Sequence:CCGGATCCTTCGCCGAATGCTCAAGCTCGAGCTTGAGCATTCGGCGAAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023937.3-678s21c1
Sequence:CCGGTAATTAGGAAGCATTTCGAACCTCGAGGTTCGAAATGCTTCCTAATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023937.3-606s21c1
Sequence:CCGGGGACCTGAGTGCTCTCCATATCTCGAGATATGGAGAGCACTCAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)