EMAIL THIS PAGE TO A FRIEND

MRPL35

mitochondrial ribosomal protein L35

67 Gene Product Result for
Synonyms: L35mt MRP-L35
UniProtKB ID: Q9NZE8, A6NKV6, B2RB93, Q658U7, Q8WWA2
Gene ID:
Human(51318) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified three transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 6p, 10q, and Xp. [provided by RefSeq, Jul 2008]
Mouse(66223) mitochondrial ribosomal protein L35
Rat(297334) mitochondrial ribosomal protein L35
Zebrafish(767758) mitochondrial ribosomal protein L35
chicken(422914) mitochondrial ribosomal protein L35
cow(540278) mitochondrial ribosomal protein L35
domestic cat(101088072) mitochondrial ribosomal protein L35
dog(612007) mitochondrial ribosomal protein L35
fruit fly(42588) mitochondrial ribosomal protein L35
sheep(101106507) mitochondrial ribosomal protein L35
domestic guinea pig(100727858) mitochondrial ribosomal protein L35
naked mole-rat(101697332) mitochondrial ribosomal protein L35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016622 Rosetta Predictions human pricing
NM_145644 Rosetta Predictions human pricing
NM_001106596 Rosetta Predictions rat pricing
NM_025430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056100 predicted 263
2 SASI_Hs01_00056101 predicted 268
3 SASI_Hs01_00056106 predicted 264
4 SASI_Hs01_00056107 predicted 228
5 SASI_Hs01_00056108 predicted 230
6 SASI_Hs02_00349782 predicted 268
7 SASI_Hs02_00349783 predicted 341
8 SASI_Hs02_00349784 predicted 266
9 SASI_Hs02_00349785 predicted 224
10 SASI_Hs02_00349786 predicted 219
11 SASI_Hs01_00056102 predicted 314
12 SASI_Hs01_00056103 predicted 211
13 SASI_Hs01_00056104 predicted 253
14 SASI_Hs01_00056105 predicted 242
15 SASI_Hs01_00056109 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137061 predicted 259
2 SASI_Hs01_00137062 predicted 263
3 SASI_Hs01_00137067 predicted 257
4 SASI_Hs01_00137068 predicted 226
5 SASI_Hs01_00137069 predicted 227
6 SASI_Hs02_00365258 predicted 268
7 SASI_Hs02_00365259 predicted 341
8 SASI_Hs02_00365260 predicted 271
9 SASI_Hs02_00365261 predicted 226
10 SASI_Hs02_00365262 predicted 216
11 SASI_Hs01_00137063 predicted 318
12 SASI_Hs01_00137064 predicted 204
13 SASI_Hs01_00137065 predicted 251
14 SASI_Hs01_00137066 predicted 242
15 SASI_Hs01_00137070 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220508 predicted 680
2 SASI_Rn02_00220509 predicted 758
3 SASI_Rn02_00220510 predicted 454
4 SASI_Rn02_00220511 predicted 576
5 SASI_Rn02_00220512 predicted 488
6 SASI_Rn02_00220513 predicted 760
7 SASI_Rn02_00220514 predicted 583
8 SASI_Rn02_00220515 predicted 474
9 SASI_Rn02_00220516 predicted 476
10 SASI_Rn02_00220517 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328237 predicted 564
2 SASI_Mm01_00143042 predicted 444
3 SASI_Mm01_00143043 predicted 773
4 SASI_Mm01_00143045 predicted 652
5 SASI_Mm01_00143046 predicted 226
6 SASI_Mm01_00143047 predicted 698
7 SASI_Mm01_00143049 predicted 543
8 SASI_Mm01_00143050 predicted 567
9 SASI_Mm01_00143051 predicted 217
10 SASI_Mm02_00328238 predicted 641
11 SASI_Mm01_00143044 predicted 562
12 SASI_Mm01_00143048 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016622
VALIDATED
MRPL35 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L35
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138794    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016622.2-2300s1c1
Sequence:CCGGGCCTGAAACATGGAATGGCATCTCGAGATGCCATTCCATGTTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016622.2-1350s1c1
Sequence:CCGGCCCGCTTTGTATTAGCAGGTTCTCGAGAACCTGCTAATACAAAGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016622.2-403s1c1
Sequence:CCGGGAGGAGAAAGGCTGGCTATAACTCGAGTTATAGCCAGCCTTTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016622.2-367s1c1
Sequence:CCGGCGATAGGTTTCTTCGACTTCACTCGAGTGAAGTCGAAGAAACCTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016622.2-2145s1c1
Sequence:CCGGGCCAGGATTATTAGGGAGATTCTCGAGAATCTCCCTAATAATCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016622.2-539s1c1
Sequence:CCGGCGAAACTGGTACGTTGATGATCTCGAGATCATCAACGTACCAGTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016622.2-126s1c1
Sequence:CCGGGTGTCAAGAATGCCTCTCTTACTCGAGTAAGAGAGGCATTCTTGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016622.2-1968s1c1
Sequence:CCGGCCGATCAGAATCATCTGGGAACTCGAGTTCCCAGATGATTCTGATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-427s21c1
Sequence:CCGGGAGGAGAAAGGCTGGCTATAACTCGAGTTATAGCCAGCCTTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-150s21c1
Sequence:CCGGGTGTCAAGAATGCCTCTCTTACTCGAGTAAGAGAGGCATTCTTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-268s21c1
Sequence:CCGGGCATACCTCAGTGATCCTTAACTCGAGTTAAGGATCACTGAGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-717s21c1
Sequence:CCGGTTGTACCAATGAATACGTAAACTCGAGTTTACGTATTCATTGGTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-326s21c1
Sequence:CCGGCCAGTCAGATCTCTAACATACCTCGAGGTATGTTAGAGATCTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016622
VALIDATED
MRPL35 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L35
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138794    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016622.2-2300s1c1
Sequence:CCGGGCCTGAAACATGGAATGGCATCTCGAGATGCCATTCCATGTTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016622.2-1350s1c1
Sequence:CCGGCCCGCTTTGTATTAGCAGGTTCTCGAGAACCTGCTAATACAAAGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016622.2-403s1c1
Sequence:CCGGGAGGAGAAAGGCTGGCTATAACTCGAGTTATAGCCAGCCTTTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016622.2-367s1c1
Sequence:CCGGCGATAGGTTTCTTCGACTTCACTCGAGTGAAGTCGAAGAAACCTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016622.2-2145s1c1
Sequence:CCGGGCCAGGATTATTAGGGAGATTCTCGAGAATCTCCCTAATAATCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016622.2-539s1c1
Sequence:CCGGCGAAACTGGTACGTTGATGATCTCGAGATCATCAACGTACCAGTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016622.2-126s1c1
Sequence:CCGGGTGTCAAGAATGCCTCTCTTACTCGAGTAAGAGAGGCATTCTTGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016622.2-1968s1c1
Sequence:CCGGCCGATCAGAATCATCTGGGAACTCGAGTTCCCAGATGATTCTGATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-427s21c1
Sequence:CCGGGAGGAGAAAGGCTGGCTATAACTCGAGTTATAGCCAGCCTTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-150s21c1
Sequence:CCGGGTGTCAAGAATGCCTCTCTTACTCGAGTAAGAGAGGCATTCTTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-268s21c1
Sequence:CCGGGCATACCTCAGTGATCCTTAACTCGAGTTAAGGATCACTGAGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-717s21c1
Sequence:CCGGTTGTACCAATGAATACGTAAACTCGAGTTTACGTATTCATTGGTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-326s21c1
Sequence:CCGGCCAGTCAGATCTCTAACATACCTCGAGGTATGTTAGAGATCTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016622
VALIDATED
MRPL35 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L35
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138794    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016622.2-2300s1c1
Sequence:CCGGGCCTGAAACATGGAATGGCATCTCGAGATGCCATTCCATGTTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016622.2-1350s1c1
Sequence:CCGGCCCGCTTTGTATTAGCAGGTTCTCGAGAACCTGCTAATACAAAGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016622.2-403s1c1
Sequence:CCGGGAGGAGAAAGGCTGGCTATAACTCGAGTTATAGCCAGCCTTTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016622.2-367s1c1
Sequence:CCGGCGATAGGTTTCTTCGACTTCACTCGAGTGAAGTCGAAGAAACCTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016622.2-2145s1c1
Sequence:CCGGGCCAGGATTATTAGGGAGATTCTCGAGAATCTCCCTAATAATCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016622.2-539s1c1
Sequence:CCGGCGAAACTGGTACGTTGATGATCTCGAGATCATCAACGTACCAGTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016622.2-126s1c1
Sequence:CCGGGTGTCAAGAATGCCTCTCTTACTCGAGTAAGAGAGGCATTCTTGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016622.2-1968s1c1
Sequence:CCGGCCGATCAGAATCATCTGGGAACTCGAGTTCCCAGATGATTCTGATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-427s21c1
Sequence:CCGGGAGGAGAAAGGCTGGCTATAACTCGAGTTATAGCCAGCCTTTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-150s21c1
Sequence:CCGGGTGTCAAGAATGCCTCTCTTACTCGAGTAAGAGAGGCATTCTTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-268s21c1
Sequence:CCGGGCATACCTCAGTGATCCTTAACTCGAGTTAAGGATCACTGAGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-717s21c1
Sequence:CCGGTTGTACCAATGAATACGTAAACTCGAGTTTACGTATTCATTGGTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016622.3-326s21c1
Sequence:CCGGCCAGTCAGATCTCTAACATACCTCGAGGTATGTTAGAGATCTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025430
VALIDATED
MRPL35 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L35
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025430.1-1346s1c1
Sequence:CCGGGCTCTCTTAGTTGTATCAGTACTCGAGTACTGATACAACTAAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025430.1-714s1c1
Sequence:CCGGGCATTAAACATTCCCAGAGTTCTCGAGAACTCTGGGAATGTTTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025430.2-1354s21c1
Sequence:CCGGGTTGTATCAGTAGGTTCATATCTCGAGATATGAACCTACTGATACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-49s21c1
Sequence:CCGGAGAGCTGCCTCAGGAATATTTCTCGAGAAATATTCCTGAGGCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-388s21c1
Sequence:CCGGAGGAGAAAGGCTGGCTATAAGCTCGAGCTTATAGCCAGCCTTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-564s21c1
Sequence:CCGGTCGAACAAACCTACGAGTATACTCGAGTATACTCGTAGGTTTGTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-230s21c1
Sequence:CCGGATACCACAACAGTCCTTAATACTCGAGTATTAAGGACTGTTGTGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025430
VALIDATED
MRPL35 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L35
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025430.1-1346s1c1
Sequence:CCGGGCTCTCTTAGTTGTATCAGTACTCGAGTACTGATACAACTAAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025430.1-714s1c1
Sequence:CCGGGCATTAAACATTCCCAGAGTTCTCGAGAACTCTGGGAATGTTTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025430.2-1354s21c1
Sequence:CCGGGTTGTATCAGTAGGTTCATATCTCGAGATATGAACCTACTGATACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-49s21c1
Sequence:CCGGAGAGCTGCCTCAGGAATATTTCTCGAGAAATATTCCTGAGGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-388s21c1
Sequence:CCGGAGGAGAAAGGCTGGCTATAAGCTCGAGCTTATAGCCAGCCTTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-564s21c1
Sequence:CCGGTCGAACAAACCTACGAGTATACTCGAGTATACTCGTAGGTTTGTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-230s21c1
Sequence:CCGGATACCACAACAGTCCTTAATACTCGAGTATTAAGGACTGTTGTGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025430
VALIDATED
MRPL35 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L35
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025430.1-1346s1c1
Sequence:CCGGGCTCTCTTAGTTGTATCAGTACTCGAGTACTGATACAACTAAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025430.1-714s1c1
Sequence:CCGGGCATTAAACATTCCCAGAGTTCTCGAGAACTCTGGGAATGTTTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025430.2-1354s21c1
Sequence:CCGGGTTGTATCAGTAGGTTCATATCTCGAGATATGAACCTACTGATACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-49s21c1
Sequence:CCGGAGAGCTGCCTCAGGAATATTTCTCGAGAAATATTCCTGAGGCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-388s21c1
Sequence:CCGGAGGAGAAAGGCTGGCTATAAGCTCGAGCTTATAGCCAGCCTTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-564s21c1
Sequence:CCGGTCGAACAAACCTACGAGTATACTCGAGTATACTCGTAGGTTTGTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025430.2-230s21c1
Sequence:CCGGATACCACAACAGTCCTTAATACTCGAGTATTAAGGACTGTTGTGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)