EMAIL THIS PAGE TO A FRIEND

MRPL36

mitochondrial ribosomal protein L36

46 Gene Product Result for
Synonyms: BRIP1 L36mt MRP-L36 PRPL36 RPMJ
UniProtKB ID: Q9P0J6, A4UCS0, B2R4Z2, Q3SWV6, Q9UKL7
Gene ID:
Human(64979) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 2p. [provided by RefSeq, Jul 2008]
Mouse(94066) mitochondrial ribosomal protein L36
Rat(364656) mitochondrial ribosomal protein L36
Zebrafish(100093703) mitochondrial ribosomal protein L36
fruit fly(59151) mitochondrial ribosomal protein L36
cow(504663) mitochondrial ribosomal protein L36
domestic cat(101101367) mitochondrial ribosomal protein L36
dog(488065) mitochondrial ribosomal protein L36
chicken(101749234) mitochondrial ribosomal protein L36
chicken(101666551) mitochondrial ribosomal protein L36
naked mole-rat(101710177) mitochondrial ribosomal protein L36
domestic guinea pig(101787311) mitochondrial ribosomal protein L36
sheep(101103507) mitochondrial ribosomal protein L36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032479 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032479 Rosetta Predictions human pricing
NM_001108879 Rosetta Predictions rat pricing
NM_053163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049414 predicted 290
2 SASI_Hs01_00049415 predicted 264
3 SASI_Hs01_00049416 predicted 312
4 SASI_Hs01_00049417 predicted 313
5 SASI_Hs01_00049418 predicted 279
6 SASI_Hs01_00049419 predicted 290
7 SASI_Hs01_00049420 predicted 317
8 SASI_Hs01_00049421 predicted 266
9 SASI_Hs01_00049422 predicted 318
10 SASI_Hs01_00049423 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242985 predicted 222
2 SASI_Rn02_00242986 predicted 410
3 SASI_Rn02_00242987 predicted 488
4 SASI_Rn02_00242988 predicted 488
5 SASI_Rn02_00242989 predicted 463
6 SASI_Rn02_00242990 predicted 320
7 SASI_Rn02_00242991 predicted 515
8 SASI_Rn02_00242992 predicted 313
9 SASI_Rn02_00242993 predicted 292
10 SASI_Rn02_00242994 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095927 predicted 489
2 SASI_Mm01_00095928 predicted 522
3 SASI_Mm01_00095929 predicted 485
4 SASI_Mm01_00095931 predicted 576
5 SASI_Mm01_00095932 predicted 624
6 SASI_Mm02_00337690 predicted 582
7 SASI_Mm01_00095933 predicted 566
8 SASI_Mm01_00095934 predicted 410
9 SASI_Mm01_00095936 predicted 377
10 SASI_Mm02_00337691 predicted 459
11 SASI_Mm01_00095930 predicted 615
12 SASI_Mm01_00095935 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032479
MRPL36 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L36
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032479.3-89s21c1
Sequence:CCGGTGGTGAACCCTCTGCTCTATCCTCGAGGATAGAGCAGAGGGTTCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032479.3-423s21c1
Sequence:CCGGGGAGAATGGTTGTATCTTATGCTCGAGCATAAGATACAACCATTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032479.3-435s21c1
Sequence:CCGGTATCTTATGGAAGGAATTATCCTCGAGGATAATTCCTTCCATAAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032479.2-281s1c1
Sequence:CCGGCAAGGACTGTTACCTGGTGAACTCGAGTTCACCAGGTAACAGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-312s1c1
Sequence:CCGGCGGTGGTACGTCTACTGTAAACTCGAGTTTACAGTAGACGTACCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032479.2-399s1c1
Sequence:CCGGCATCGCATCACTTGGGAGAATCTCGAGATTCTCCCAAGTGATGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-126s1c1
Sequence:CCGGGCCCTCTCCACATTTCTATTTCTCGAGAAATAGAAATGTGGAGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-344s1c1
Sequence:CCGGGCACAAGCAGAGACAGATGTACTCGAGTACATCTGTCTCTGCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-124s1c1
Sequence:CCGGGAGCCCTCTCCACATTTCTATCTCGAGATAGAAATGTGGAGAGGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032479
MRPL36 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L36
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032479.3-89s21c1
Sequence:CCGGTGGTGAACCCTCTGCTCTATCCTCGAGGATAGAGCAGAGGGTTCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032479.3-423s21c1
Sequence:CCGGGGAGAATGGTTGTATCTTATGCTCGAGCATAAGATACAACCATTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032479.3-435s21c1
Sequence:CCGGTATCTTATGGAAGGAATTATCCTCGAGGATAATTCCTTCCATAAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032479.2-281s1c1
Sequence:CCGGCAAGGACTGTTACCTGGTGAACTCGAGTTCACCAGGTAACAGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-312s1c1
Sequence:CCGGCGGTGGTACGTCTACTGTAAACTCGAGTTTACAGTAGACGTACCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032479.2-399s1c1
Sequence:CCGGCATCGCATCACTTGGGAGAATCTCGAGATTCTCCCAAGTGATGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-126s1c1
Sequence:CCGGGCCCTCTCCACATTTCTATTTCTCGAGAAATAGAAATGTGGAGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-344s1c1
Sequence:CCGGGCACAAGCAGAGACAGATGTACTCGAGTACATCTGTCTCTGCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-124s1c1
Sequence:CCGGGAGCCCTCTCCACATTTCTATCTCGAGATAGAAATGTGGAGAGGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032479
MRPL36 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L36
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032479.3-89s21c1
Sequence:CCGGTGGTGAACCCTCTGCTCTATCCTCGAGGATAGAGCAGAGGGTTCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032479.3-423s21c1
Sequence:CCGGGGAGAATGGTTGTATCTTATGCTCGAGCATAAGATACAACCATTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032479.3-435s21c1
Sequence:CCGGTATCTTATGGAAGGAATTATCCTCGAGGATAATTCCTTCCATAAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032479.2-281s1c1
Sequence:CCGGCAAGGACTGTTACCTGGTGAACTCGAGTTCACCAGGTAACAGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-312s1c1
Sequence:CCGGCGGTGGTACGTCTACTGTAAACTCGAGTTTACAGTAGACGTACCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032479.2-399s1c1
Sequence:CCGGCATCGCATCACTTGGGAGAATCTCGAGATTCTCCCAAGTGATGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-126s1c1
Sequence:CCGGGCCCTCTCCACATTTCTATTTCTCGAGAAATAGAAATGTGGAGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-344s1c1
Sequence:CCGGGCACAAGCAGAGACAGATGTACTCGAGTACATCTGTCTCTGCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032479.2-124s1c1
Sequence:CCGGGAGCCCTCTCCACATTTCTATCTCGAGATAGAAATGTGGAGAGGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053163
VALIDATED
MRPL36 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L36
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-591s21c1
Sequence:CCGGGCTGTGTATGAAGCAGGAATACTCGAGTATTCCTGCTTCATACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-177s21c1
Sequence:CCGGCCGAGTCTTCTCCTCGTTCCTCTCGAGAGGAACGAGGAGAAGACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053163.1-381s21c1
Sequence:CCGGCAAGCATAAACAGCGACAAATCTCGAGATTTGTCGCTGTTTATGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-351s21c1
Sequence:CCGGGCGCTGGTTTATCCTCTGTAACTCGAGTTACAGAGGATAAACCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-315s21c1
Sequence:CCGGGCGCTGTAAAGACTGCTACAACTCGAGTTGTAGCAGTCTTTACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053163.1-591s1c1
Sequence:CCGGGCTGTGTATGAAGCAGGAATACTCGAGTATTCCTGCTTCATACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053163.1-380s1c1
Sequence:CCGGCCAAGCATAAACAGCGACAAACTCGAGTTTGTCGCTGTTTATGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053163.1-177s1c1
Sequence:CCGGCCGAGTCTTCTCCTCGTTCCTCTCGAGAGGAACGAGGAGAAGACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053163.1-315s1c1
Sequence:CCGGGCGCTGTAAAGACTGCTACAACTCGAGTTGTAGCAGTCTTTACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053163.1-351s1c1
Sequence:CCGGGCGCTGGTTTATCCTCTGTAACTCGAGTTACAGAGGATAAACCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053163
VALIDATED
MRPL36 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L36
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-591s21c1
Sequence:CCGGGCTGTGTATGAAGCAGGAATACTCGAGTATTCCTGCTTCATACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-177s21c1
Sequence:CCGGCCGAGTCTTCTCCTCGTTCCTCTCGAGAGGAACGAGGAGAAGACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053163.1-381s21c1
Sequence:CCGGCAAGCATAAACAGCGACAAATCTCGAGATTTGTCGCTGTTTATGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-351s21c1
Sequence:CCGGGCGCTGGTTTATCCTCTGTAACTCGAGTTACAGAGGATAAACCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-315s21c1
Sequence:CCGGGCGCTGTAAAGACTGCTACAACTCGAGTTGTAGCAGTCTTTACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053163.1-591s1c1
Sequence:CCGGGCTGTGTATGAAGCAGGAATACTCGAGTATTCCTGCTTCATACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053163.1-380s1c1
Sequence:CCGGCCAAGCATAAACAGCGACAAACTCGAGTTTGTCGCTGTTTATGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053163.1-177s1c1
Sequence:CCGGCCGAGTCTTCTCCTCGTTCCTCTCGAGAGGAACGAGGAGAAGACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053163.1-315s1c1
Sequence:CCGGGCGCTGTAAAGACTGCTACAACTCGAGTTGTAGCAGTCTTTACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053163.1-351s1c1
Sequence:CCGGGCGCTGGTTTATCCTCTGTAACTCGAGTTACAGAGGATAAACCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053163
VALIDATED
MRPL36 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L36
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-591s21c1
Sequence:CCGGGCTGTGTATGAAGCAGGAATACTCGAGTATTCCTGCTTCATACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-177s21c1
Sequence:CCGGCCGAGTCTTCTCCTCGTTCCTCTCGAGAGGAACGAGGAGAAGACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053163.1-381s21c1
Sequence:CCGGCAAGCATAAACAGCGACAAATCTCGAGATTTGTCGCTGTTTATGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-351s21c1
Sequence:CCGGGCGCTGGTTTATCCTCTGTAACTCGAGTTACAGAGGATAAACCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053163.1-315s21c1
Sequence:CCGGGCGCTGTAAAGACTGCTACAACTCGAGTTGTAGCAGTCTTTACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053163.1-591s1c1
Sequence:CCGGGCTGTGTATGAAGCAGGAATACTCGAGTATTCCTGCTTCATACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053163.1-380s1c1
Sequence:CCGGCCAAGCATAAACAGCGACAAACTCGAGTTTGTCGCTGTTTATGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053163.1-177s1c1
Sequence:CCGGCCGAGTCTTCTCCTCGTTCCTCTCGAGAGGAACGAGGAGAAGACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053163.1-315s1c1
Sequence:CCGGGCGCTGTAAAGACTGCTACAACTCGAGTTGTAGCAGTCTTTACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053163.1-351s1c1
Sequence:CCGGGCGCTGGTTTATCCTCTGTAACTCGAGTTACAGAGGATAAACCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)