EMAIL THIS PAGE TO A FRIEND

MRPL37

mitochondrial ribosomal protein L37

54 Gene Product Result for
Synonyms: L37mt MRP-L2 MRP-L37 MRPL2 RPML2
UniProtKB ID: Q9BZE1, Q96Q67, Q9BWR1, Q9P0P3
Gene ID:
Human(51253) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(56280) mitochondrial ribosomal protein L37
Rat(56281) mitochondrial ribosomal protein L37
Zebrafish(567819) mitochondrial ribosomal protein L37
domestic cat(101097003) mitochondrial ribosomal protein L37
cow(510127) mitochondrial ribosomal protein L37
dog(489577) mitochondrial ribosomal protein L37
chicken(772313) mitochondrial ribosomal protein L37
fruit fly(41293) mitochondrial ribosomal protein L37
sheep(101121893) mitochondrial ribosomal protein L37
domestic guinea pig(100734604) mitochondrial ribosomal protein L37
naked mole-rat(101700804) mitochondrial ribosomal protein L37
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016491 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016491 Rosetta Predictions human pricing
NM_001004235 Rosetta Predictions rat pricing
NM_025500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227749 predicted 621
2 SASI_Hs01_00227750 predicted 312
3 SASI_Hs01_00227751 predicted 853
4 SASI_Hs01_00227752 predicted 878
5 SASI_Hs01_00227753 predicted 634
6 SASI_Hs01_00227754 predicted 472
7 SASI_Hs01_00227755 predicted 649
8 SASI_Hs01_00227756 predicted 1172
9 SASI_Hs01_00227757 predicted 208
10 SASI_Hs01_00227758 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067030 predicted 417
2 SASI_Rn01_00067031 predicted 610
3 SASI_Rn01_00067032 predicted 219
4 SASI_Rn01_00067033 predicted 567
5 SASI_Rn01_00067034 predicted 875
6 SASI_Rn01_00067035 predicted 449
7 SASI_Rn01_00067036 predicted 987
8 SASI_Rn01_00067037 predicted 617
9 SASI_Rn01_00067038 predicted 459
10 SASI_Rn01_00067039 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099928 predicted 487
2 SASI_Mm02_00328381 predicted 624
3 SASI_Mm01_00099929 predicted 422
4 SASI_Mm01_00099930 predicted 229
5 SASI_Mm01_00099932 predicted 1002
6 SASI_Mm01_00099933 predicted 575
7 SASI_Mm01_00099934 predicted 467
8 SASI_Mm01_00099935 predicted 623
9 SASI_Mm01_00099936 predicted 361
10 SASI_Mm01_00099937 predicted 454
11 SASI_Mm01_00099931 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025500
MRPL37 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L37
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-865s21c1
Sequence:CCGGCCACGTTTATGAAGTGAAAGACTCGAGTCTTTCACTTCATAAACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-1000s21c1
Sequence:CCGGGCTCCTGTTTGCTTTCGCAAACTCGAGTTTGCGAAAGCAAACAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-619s21c1
Sequence:CCGGGCTGTGTAAATCCCAGATTCTCTCGAGAGAATCTGGGATTTACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-865s1c1
Sequence:CCGGCCACGTTTATGAAGTGAAAGACTCGAGTCTTTCACTTCATAAACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-1307s1c1
Sequence:CCGGGCTCTGTACTTGCATGGTGTTCTCGAGAACACCATGCAAGTACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-427s1c1
Sequence:CCGGGCTTACTAAGACCAAGTTAATCTCGAGATTAACTTGGTCTTAGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-1307s21c1
Sequence:CCGGGCTCTGTACTTGCATGGTGTTCTCGAGAACACCATGCAAGTACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-1000s1c1
Sequence:CCGGGCTCCTGTTTGCTTTCGCAAACTCGAGTTTGCGAAAGCAAACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-476s1c1
Sequence:CCGGCTTGTTGATGATCCAGCTAATCTCGAGATTAGCTGGATCATCAACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025500
MRPL37 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L37
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-865s21c1
Sequence:CCGGCCACGTTTATGAAGTGAAAGACTCGAGTCTTTCACTTCATAAACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-1000s21c1
Sequence:CCGGGCTCCTGTTTGCTTTCGCAAACTCGAGTTTGCGAAAGCAAACAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-619s21c1
Sequence:CCGGGCTGTGTAAATCCCAGATTCTCTCGAGAGAATCTGGGATTTACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-865s1c1
Sequence:CCGGCCACGTTTATGAAGTGAAAGACTCGAGTCTTTCACTTCATAAACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-1307s1c1
Sequence:CCGGGCTCTGTACTTGCATGGTGTTCTCGAGAACACCATGCAAGTACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-427s1c1
Sequence:CCGGGCTTACTAAGACCAAGTTAATCTCGAGATTAACTTGGTCTTAGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-1307s21c1
Sequence:CCGGGCTCTGTACTTGCATGGTGTTCTCGAGAACACCATGCAAGTACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-1000s1c1
Sequence:CCGGGCTCCTGTTTGCTTTCGCAAACTCGAGTTTGCGAAAGCAAACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-476s1c1
Sequence:CCGGCTTGTTGATGATCCAGCTAATCTCGAGATTAGCTGGATCATCAACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025500
MRPL37 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L37
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-865s21c1
Sequence:CCGGCCACGTTTATGAAGTGAAAGACTCGAGTCTTTCACTTCATAAACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-1000s21c1
Sequence:CCGGGCTCCTGTTTGCTTTCGCAAACTCGAGTTTGCGAAAGCAAACAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-619s21c1
Sequence:CCGGGCTGTGTAAATCCCAGATTCTCTCGAGAGAATCTGGGATTTACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-865s1c1
Sequence:CCGGCCACGTTTATGAAGTGAAAGACTCGAGTCTTTCACTTCATAAACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-1307s1c1
Sequence:CCGGGCTCTGTACTTGCATGGTGTTCTCGAGAACACCATGCAAGTACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-427s1c1
Sequence:CCGGGCTTACTAAGACCAAGTTAATCTCGAGATTAACTTGGTCTTAGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025500.1-1307s21c1
Sequence:CCGGGCTCTGTACTTGCATGGTGTTCTCGAGAACACCATGCAAGTACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-1000s1c1
Sequence:CCGGGCTCCTGTTTGCTTTCGCAAACTCGAGTTTGCGAAAGCAAACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025500.1-476s1c1
Sequence:CCGGCTTGTTGATGATCCAGCTAATCTCGAGATTAGCTGGATCATCAACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016491
VALIDATED
MRPL37 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L37
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-443s1c1
Sequence:CCGGGCTCACCAAGACCAAGTTAATCTCGAGATTAACTTGGTCTTGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-813s1c1
Sequence:CCGGGAAGCTACTAAGAATCATGTTCTCGAGAACATGATTCTTAGTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016491.2-858s1c1
Sequence:CCGGCCCATCATCGATCTTCATGAACTCGAGTTCATGAAGATCGATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-1214s1c1
Sequence:CCGGCCAGCTCCTCTATCAGCATTTCTCGAGAAATGCTGATAGAGGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-388s1c1
Sequence:CCGGGCTATATCTTTCACCACCGTTCTCGAGAACGGTGGTGAAAGATATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016491
VALIDATED
MRPL37 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L37
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-443s1c1
Sequence:CCGGGCTCACCAAGACCAAGTTAATCTCGAGATTAACTTGGTCTTGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-813s1c1
Sequence:CCGGGAAGCTACTAAGAATCATGTTCTCGAGAACATGATTCTTAGTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016491.2-858s1c1
Sequence:CCGGCCCATCATCGATCTTCATGAACTCGAGTTCATGAAGATCGATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-1214s1c1
Sequence:CCGGCCAGCTCCTCTATCAGCATTTCTCGAGAAATGCTGATAGAGGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-388s1c1
Sequence:CCGGGCTATATCTTTCACCACCGTTCTCGAGAACGGTGGTGAAAGATATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016491
VALIDATED
MRPL37 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L37
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-443s1c1
Sequence:CCGGGCTCACCAAGACCAAGTTAATCTCGAGATTAACTTGGTCTTGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-813s1c1
Sequence:CCGGGAAGCTACTAAGAATCATGTTCTCGAGAACATGATTCTTAGTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016491.2-858s1c1
Sequence:CCGGCCCATCATCGATCTTCATGAACTCGAGTTCATGAAGATCGATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-1214s1c1
Sequence:CCGGCCAGCTCCTCTATCAGCATTTCTCGAGAAATGCTGATAGAGGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016491.2-388s1c1
Sequence:CCGGGCTATATCTTTCACCACCGTTCTCGAGAACGGTGGTGAAAGATATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)