EMAIL THIS PAGE TO A FRIEND

MRPL38

mitochondrial ribosomal protein L38

55 Gene Product Result for
Synonyms: L38MT MRP-L3 MRP-L38 RPML3
UniProtKB ID: Q96DV4, Q96Q66, Q9P0B9
Gene ID:
Human(64978) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(60441) mitochondrial ribosomal protein L38
Rat(303685) mitochondrial ribosomal protein L38
Zebrafish(405881) mitochondrial ribosomal protein L38
chicken(770172) mitochondrial ribosomal protein L38
fruit fly(32375) mitochondrial ribosomal protein L38
cow(617005) mitochondrial ribosomal protein L38
domestic cat(101082026) mitochondrial ribosomal protein L38
dog(483320) mitochondrial ribosomal protein L38
naked mole-rat(101702969) mitochondrial ribosomal protein L38
domestic guinea pig(100720746) mitochondrial ribosomal protein L38
sheep(101107615) mitochondrial ribosomal protein L38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032478 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002471 MISSION® esiRNA esiRNA targeting mouse Mrpl38 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032478 Rosetta Predictions human pricing
NM_001009369 Rosetta Predictions rat pricing
NM_024177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105305 predicted 1479
2 SASI_Hs01_00105306 predicted 1634
3 SASI_Hs01_00105307 predicted 621
4 SASI_Hs01_00105308 predicted 622
5 SASI_Hs02_00359930 predicted 982
6 SASI_Hs01_00105311 predicted 761
7 SASI_Hs01_00105312 predicted 1349
8 SASI_Hs01_00105313 predicted 1134
9 SASI_Hs01_00105314 predicted 814
10 SASI_Hs02_00359931 predicted 1057
11 SASI_Hs01_00105309 predicted 1167
12 SASI_Hs01_00105310 predicted 1627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097016 predicted 528
2 SASI_Rn01_00097017 predicted 802
3 SASI_Rn01_00097018 predicted 943
4 SASI_Rn01_00097019 predicted 630
5 SASI_Rn02_00199522 predicted 989
6 SASI_Rn02_00199523 predicted 342
7 SASI_Rn01_00097021 predicted 567
8 SASI_Rn01_00097022 predicted 247
9 SASI_Rn01_00097023 predicted 623
10 SASI_Rn02_00199524 predicted 889
11 SASI_Rn01_00097020 predicted 897
12 SASI_Rn01_00097024 predicted 222
13 SASI_Rn01_00097025 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091534 predicted 643
2 SASI_Mm01_00091535 predicted 401
3 SASI_Mm01_00091536 predicted 1103
4 SASI_Mm02_00327496 predicted 565
5 SASI_Mm01_00091537 predicted 715
6 SASI_Mm01_00091538 predicted 1068
7 SASI_Mm01_00091540 predicted 971
8 SASI_Mm01_00091541 predicted 643
9 SASI_Mm01_00091542 predicted 1018
10 SASI_Mm01_00091543 predicted 922
11 SASI_Mm01_00091539 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024177
VALIDATED
MRPL38 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L38
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-647s21c1
Sequence:CCGGCCGGTGTATCATGGCAATGAACTCGAGTTCATTGCCATGATACACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-799s21c1
Sequence:CCGGGCTAACCAACATCCCAAGCAACTCGAGTTGCTTGGGATGTTGGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-1103s21c1
Sequence:CCGGCGGGAACCTGTGTTTGAATTTCTCGAGAAATTCAAACACAGGTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-913s21c1
Sequence:CCGGGCAGGACAAGCCAATCAACTTCTCGAGAAGTTGATTGGCTTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024177.2-1028s1c1
Sequence:CCGGGCTAACCAACATCCCAAGCAACTCGAGTTGCTTGGGATGTTGGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024177.2-1142s1c1
Sequence:CCGGGCAGGACAAGCCAATCAACTTCTCGAGAAGTTGATTGGCTTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024177.2-1467s1c1
Sequence:CCGGACTCAGTACATTCATCTCCGACTCGAGTCGGAGATGAATGTACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024177.2-876s1c1
Sequence:CCGGCCGGTGTATCATGGCAATGAACTCGAGTTCATTGCCATGATACACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024177.2-1332s1c1
Sequence:CCGGCGGGAACCTGTGTTTGAATTTCTCGAGAAATTCAAACACAGGTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024177
VALIDATED
MRPL38 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L38
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-647s21c1
Sequence:CCGGCCGGTGTATCATGGCAATGAACTCGAGTTCATTGCCATGATACACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-799s21c1
Sequence:CCGGGCTAACCAACATCCCAAGCAACTCGAGTTGCTTGGGATGTTGGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-1103s21c1
Sequence:CCGGCGGGAACCTGTGTTTGAATTTCTCGAGAAATTCAAACACAGGTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-913s21c1
Sequence:CCGGGCAGGACAAGCCAATCAACTTCTCGAGAAGTTGATTGGCTTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024177.2-1028s1c1
Sequence:CCGGGCTAACCAACATCCCAAGCAACTCGAGTTGCTTGGGATGTTGGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024177.2-1142s1c1
Sequence:CCGGGCAGGACAAGCCAATCAACTTCTCGAGAAGTTGATTGGCTTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024177.2-1467s1c1
Sequence:CCGGACTCAGTACATTCATCTCCGACTCGAGTCGGAGATGAATGTACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024177.2-876s1c1
Sequence:CCGGCCGGTGTATCATGGCAATGAACTCGAGTTCATTGCCATGATACACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024177.2-1332s1c1
Sequence:CCGGCGGGAACCTGTGTTTGAATTTCTCGAGAAATTCAAACACAGGTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024177
VALIDATED
MRPL38 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L38
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-647s21c1
Sequence:CCGGCCGGTGTATCATGGCAATGAACTCGAGTTCATTGCCATGATACACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-799s21c1
Sequence:CCGGGCTAACCAACATCCCAAGCAACTCGAGTTGCTTGGGATGTTGGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-1103s21c1
Sequence:CCGGCGGGAACCTGTGTTTGAATTTCTCGAGAAATTCAAACACAGGTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024177.3-913s21c1
Sequence:CCGGGCAGGACAAGCCAATCAACTTCTCGAGAAGTTGATTGGCTTGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024177.2-1028s1c1
Sequence:CCGGGCTAACCAACATCCCAAGCAACTCGAGTTGCTTGGGATGTTGGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024177.2-1142s1c1
Sequence:CCGGGCAGGACAAGCCAATCAACTTCTCGAGAAGTTGATTGGCTTGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024177.2-1467s1c1
Sequence:CCGGACTCAGTACATTCATCTCCGACTCGAGTCGGAGATGAATGTACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024177.2-876s1c1
Sequence:CCGGCCGGTGTATCATGGCAATGAACTCGAGTTCATTGCCATGATACACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024177.2-1332s1c1
Sequence:CCGGCGGGAACCTGTGTTTGAATTTCTCGAGAAATTCAAACACAGGTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032478
VALIDATED
MRPL38 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L38
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032478.3-934s21c1
Sequence:CCGGCTAACCAACATCCCGGGTAACCTCGAGGTTACCCGGGATGTTGGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032478.3-475s21c1
Sequence:CCGGCCCAAAGAGAAGATTGATATTCTCGAGAATATCAATCTTCTCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032478.2-1640s1c2
Sequence:CCGGGCCCACCTATGGCATCTACTACTCGAGTAGTAGATGCCATAGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032478.3-1383s21c1
Sequence:CCGGCGCATTTCAGAGCATGGGATTCTCGAGAATCCCATGCTCTGAAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032478.3-670s21c1
Sequence:CCGGCAGCGTCTGGCTGAGTATTACCTCGAGGTAATACTCAGCCAGACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032478.3-438s21c1
Sequence:CCGGGCGGACCTACCGAGAGTATTTCTCGAGAAATACTCTCGGTAGGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-1676s1c1
Sequence:CCGGCGCATTTCAGAGCATGGGATTCTCGAGAATCCCATGCTCTGAAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-1500s1c1
Sequence:CCGGACCTACATCTTCCACCAGCTTCTCGAGAAGCTGGTGGAAGATGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-768s1c1
Sequence:CCGGCCCAAAGAGAAGATTGATATTCTCGAGAATATCAATCTTCTCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-819s1c1
Sequence:CCGGCAACAGCTACTGGAACGGAAACTCGAGTTTCCGTTCCAGTAGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032478
VALIDATED
MRPL38 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L38
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032478.3-934s21c1
Sequence:CCGGCTAACCAACATCCCGGGTAACCTCGAGGTTACCCGGGATGTTGGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032478.3-475s21c1
Sequence:CCGGCCCAAAGAGAAGATTGATATTCTCGAGAATATCAATCTTCTCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032478.2-1640s1c2
Sequence:CCGGGCCCACCTATGGCATCTACTACTCGAGTAGTAGATGCCATAGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032478.3-1383s21c1
Sequence:CCGGCGCATTTCAGAGCATGGGATTCTCGAGAATCCCATGCTCTGAAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032478.3-670s21c1
Sequence:CCGGCAGCGTCTGGCTGAGTATTACCTCGAGGTAATACTCAGCCAGACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032478.3-438s21c1
Sequence:CCGGGCGGACCTACCGAGAGTATTTCTCGAGAAATACTCTCGGTAGGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-1676s1c1
Sequence:CCGGCGCATTTCAGAGCATGGGATTCTCGAGAATCCCATGCTCTGAAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-1500s1c1
Sequence:CCGGACCTACATCTTCCACCAGCTTCTCGAGAAGCTGGTGGAAGATGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-768s1c1
Sequence:CCGGCCCAAAGAGAAGATTGATATTCTCGAGAATATCAATCTTCTCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-819s1c1
Sequence:CCGGCAACAGCTACTGGAACGGAAACTCGAGTTTCCGTTCCAGTAGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032478
VALIDATED
MRPL38 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L38
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032478.3-934s21c1
Sequence:CCGGCTAACCAACATCCCGGGTAACCTCGAGGTTACCCGGGATGTTGGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032478.3-475s21c1
Sequence:CCGGCCCAAAGAGAAGATTGATATTCTCGAGAATATCAATCTTCTCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032478.2-1640s1c2
Sequence:CCGGGCCCACCTATGGCATCTACTACTCGAGTAGTAGATGCCATAGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032478.3-1383s21c1
Sequence:CCGGCGCATTTCAGAGCATGGGATTCTCGAGAATCCCATGCTCTGAAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032478.3-670s21c1
Sequence:CCGGCAGCGTCTGGCTGAGTATTACCTCGAGGTAATACTCAGCCAGACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032478.3-438s21c1
Sequence:CCGGGCGGACCTACCGAGAGTATTTCTCGAGAAATACTCTCGGTAGGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-1676s1c1
Sequence:CCGGCGCATTTCAGAGCATGGGATTCTCGAGAATCCCATGCTCTGAAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-1500s1c1
Sequence:CCGGACCTACATCTTCCACCAGCTTCTCGAGAAGCTGGTGGAAGATGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-768s1c1
Sequence:CCGGCCCAAAGAGAAGATTGATATTCTCGAGAATATCAATCTTCTCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032478.2-819s1c1
Sequence:CCGGCAACAGCTACTGGAACGGAAACTCGAGTTTCCGTTCCAGTAGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)