EMAIL THIS PAGE TO A FRIEND

MRPL39

mitochondrial ribosomal protein L39

64 Gene Product Result for
Synonyms: C21orf92 L39mt MRP-L5 MRPL5 PRED22 PRED66 RPML5
Gene ID:
Human(54148) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Two transcript variants encoding distinct isoforms have been described. A pseudogene corresponding to this gene is found on chromosome 5q. [provided by RefSeq, Jul 2008]
Mouse(27393) mitochondrial ribosomal protein L39
Rat(684304) mitochondrial ribosomal protein L39
sheep(101113977) mitochondrial ribosomal protein L39
domestic guinea pig(100727380) mitochondrial ribosomal protein L39
naked mole-rat(101721783) mitochondrial ribosomal protein L39
Zebrafish(334588) mitochondrial ribosomal protein L39
cow(515194) mitochondrial ribosomal protein L39
domestic cat(101101155) mitochondrial ribosomal protein L39
dog(487709) mitochondrial ribosomal protein L39
chicken(418475) mitochondrial ribosomal protein L39
fruit fly(39627) mitochondrial ribosomal protein L39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017446 Rosetta Predictions human pricing
NM_080794 Rosetta Predictions human pricing
XM_001069799 Rosetta Predictions rat pricing
NM_017404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350051 predicted 263
2 SASI_Hs01_00187122 predicted 269
3 SASI_Hs01_00187123 predicted 206
4 SASI_Hs01_00187124 predicted 283
5 SASI_Hs01_00187125 predicted 352
6 SASI_Hs01_00187126 predicted 539
7 SASI_Hs01_00187127 predicted 362
8 SASI_Hs02_00350052 predicted 529
9 SASI_Hs01_00187129 predicted 274
10 SASI_Hs01_00187130 predicted 602
11 SASI_Hs01_00187121 predicted 717
12 SASI_Hs01_00187128 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362558 predicted 264
2 SASI_Hs01_00220307 predicted 270
3 SASI_Hs01_00220308 predicted 209
4 SASI_Hs01_00220309 predicted 291
5 SASI_Hs01_00220310 predicted 347
6 SASI_Hs01_00220311 predicted 540
7 SASI_Hs01_00220312 predicted 360
8 SASI_Hs02_00362559 predicted 531
9 SASI_Hs01_00220314 predicted 276
10 SASI_Hs01_00220315 predicted 600
11 SASI_Hs01_00220306 predicted 713
12 SASI_Hs01_00220313 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329353 predicted 455
2 SASI_Rn02_00329354 predicted 680
3 SASI_Rn02_00329355 predicted 258
4 SASI_Rn02_00329356 predicted 542
5 SASI_Rn02_00329357 predicted 378
6 SASI_Rn02_00329358 predicted 506
7 SASI_Rn02_00329359 predicted 710
8 SASI_Rn02_00329360 predicted 270
9 SASI_Rn02_00329361 predicted 202
10 SASI_Rn02_00329362 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188819 predicted 321
2 SASI_Mm02_00323910 predicted 541
3 SASI_Mm02_00323911 predicted 233
4 SASI_Mm01_00188824 predicted 463
5 SASI_Mm02_00323912 predicted 279
6 SASI_Mm02_00323913 predicted 368
7 SASI_Mm02_00323914 predicted 616
8 SASI_Mm02_00323915 predicted 278
9 SASI_Mm01_00188827 predicted 392
10 SASI_Mm02_00323916 predicted 234
11 SASI_Mm01_00188820 predicted 640
12 SASI_Mm01_00188821 predicted 880
13 SASI_Mm01_00188822 predicted 535
14 SASI_Mm01_00188823 predicted 915
15 SASI_Mm01_00188825 predicted 917
16 SASI_Mm01_00188826 predicted 1002
17 SASI_Mm01_00188828 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017446
MRPL39 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L39
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017446.3-472s21c1
Sequence:CCGCTGATAGAGAGGGCATTCAAAGCTCGAGCTTTGAATGCCCTCTCTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017446.3-170s21c1
Sequence:CCGGAGCCAGGCAGTTATCATTAACCTCGAGGTTAATGATAACTGCCTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-811s1c1
Sequence:CCGGGCCCTCTTATTCCAAGAACAACTCGAGTTGTTCTTGGAATAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-884s1c1
Sequence:CCGGGCCAAGTCTCATACGAAGATTCTCGAGAATCTTCGTATGAGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017446.3-292s21c1
Sequence:CCGGTGCATTTAAGCGAGTGGTATTCTCGAGAATACCACTCGCTTAAATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-73s1c1
Sequence:CCGGGCGGGATCAAATGGAGATTTACTCGAGTAAATCTCCATTTGATCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-546s1c1
Sequence:CCGGGCCTTCTGTTATGACGTAGTTCTCGAGAACTACGTCATAACAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-921s1c1
Sequence:CCGGCCTGTTCACTTAAGAGCACATCTCGAGATGTGCTCTTAAGTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017446
MRPL39 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L39
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017446.3-472s21c1
Sequence:CCGCTGATAGAGAGGGCATTCAAAGCTCGAGCTTTGAATGCCCTCTCTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017446.3-170s21c1
Sequence:CCGGAGCCAGGCAGTTATCATTAACCTCGAGGTTAATGATAACTGCCTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-811s1c1
Sequence:CCGGGCCCTCTTATTCCAAGAACAACTCGAGTTGTTCTTGGAATAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-884s1c1
Sequence:CCGGGCCAAGTCTCATACGAAGATTCTCGAGAATCTTCGTATGAGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017446.3-292s21c1
Sequence:CCGGTGCATTTAAGCGAGTGGTATTCTCGAGAATACCACTCGCTTAAATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-73s1c1
Sequence:CCGGGCGGGATCAAATGGAGATTTACTCGAGTAAATCTCCATTTGATCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-546s1c1
Sequence:CCGGGCCTTCTGTTATGACGTAGTTCTCGAGAACTACGTCATAACAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-921s1c1
Sequence:CCGGCCTGTTCACTTAAGAGCACATCTCGAGATGTGCTCTTAAGTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017446
MRPL39 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L39
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017446.3-472s21c1
Sequence:CCGCTGATAGAGAGGGCATTCAAAGCTCGAGCTTTGAATGCCCTCTCTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017446.3-170s21c1
Sequence:CCGGAGCCAGGCAGTTATCATTAACCTCGAGGTTAATGATAACTGCCTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-811s1c1
Sequence:CCGGGCCCTCTTATTCCAAGAACAACTCGAGTTGTTCTTGGAATAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-884s1c1
Sequence:CCGGGCCAAGTCTCATACGAAGATTCTCGAGAATCTTCGTATGAGACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017446.3-292s21c1
Sequence:CCGGTGCATTTAAGCGAGTGGTATTCTCGAGAATACCACTCGCTTAAATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-73s1c1
Sequence:CCGGGCGGGATCAAATGGAGATTTACTCGAGTAAATCTCCATTTGATCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-546s1c1
Sequence:CCGGGCCTTCTGTTATGACGTAGTTCTCGAGAACTACGTCATAACAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017446.2-921s1c1
Sequence:CCGGCCTGTTCACTTAAGAGCACATCTCGAGATGTGCTCTTAAGTGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017404
VALIDATED
MRPL39 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L39
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-826s21c1
Sequence:CCGGCCGAACCTCATTCGCAGATTTCTCGAGAAATCTGCGAATGAGGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017404.2-1432s1c1
Sequence:CCGGCCCACTTGTTAAGACAGTGTTCTCGAGAACACTGTCTTAACAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-868s1c1
Sequence:CCGGCCGAACCTCATTCGCAGATTTCTCGAGAAATCTGCGAATGAGGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-673s1c1
Sequence:CCGGGCGCTGGAAATATTTCAACATCTCGAGATGTTGAAATATTTCCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-739s1c1
Sequence:CCGGCCCGAGAGAATAGTCAAGTTACTCGAGTAACTTGACTATTCTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-697s21c1
Sequence:CCGGCCCGAGAGAATAGTCAAGTTACTCGAGTAACTTGACTATTCTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-136s21c1
Sequence:CCGGCGAACGGAGAAGATCGAAGTTCTCGAGAACTTCGATCTTCTCCGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-631s21c1
Sequence:CCGGGCGCTGGAAATATTTCAACATCTCGAGATGTTGAAATATTTCCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-178s1c1
Sequence:CCGGCGAACGGAGAAGATCGAAGTTCTCGAGAACTTCGATCTTCTCCGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017404
VALIDATED
MRPL39 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L39
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-826s21c1
Sequence:CCGGCCGAACCTCATTCGCAGATTTCTCGAGAAATCTGCGAATGAGGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017404.2-1432s1c1
Sequence:CCGGCCCACTTGTTAAGACAGTGTTCTCGAGAACACTGTCTTAACAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-868s1c1
Sequence:CCGGCCGAACCTCATTCGCAGATTTCTCGAGAAATCTGCGAATGAGGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-673s1c1
Sequence:CCGGGCGCTGGAAATATTTCAACATCTCGAGATGTTGAAATATTTCCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-739s1c1
Sequence:CCGGCCCGAGAGAATAGTCAAGTTACTCGAGTAACTTGACTATTCTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-697s21c1
Sequence:CCGGCCCGAGAGAATAGTCAAGTTACTCGAGTAACTTGACTATTCTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-136s21c1
Sequence:CCGGCGAACGGAGAAGATCGAAGTTCTCGAGAACTTCGATCTTCTCCGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-631s21c1
Sequence:CCGGGCGCTGGAAATATTTCAACATCTCGAGATGTTGAAATATTTCCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-178s1c1
Sequence:CCGGCGAACGGAGAAGATCGAAGTTCTCGAGAACTTCGATCTTCTCCGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017404
VALIDATED
MRPL39 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L39
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-826s21c1
Sequence:CCGGCCGAACCTCATTCGCAGATTTCTCGAGAAATCTGCGAATGAGGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017404.2-1432s1c1
Sequence:CCGGCCCACTTGTTAAGACAGTGTTCTCGAGAACACTGTCTTAACAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-868s1c1
Sequence:CCGGCCGAACCTCATTCGCAGATTTCTCGAGAAATCTGCGAATGAGGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-673s1c1
Sequence:CCGGGCGCTGGAAATATTTCAACATCTCGAGATGTTGAAATATTTCCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-739s1c1
Sequence:CCGGCCCGAGAGAATAGTCAAGTTACTCGAGTAACTTGACTATTCTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-697s21c1
Sequence:CCGGCCCGAGAGAATAGTCAAGTTACTCGAGTAACTTGACTATTCTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-136s21c1
Sequence:CCGGCGAACGGAGAAGATCGAAGTTCTCGAGAACTTCGATCTTCTCCGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017404.3-631s21c1
Sequence:CCGGGCGCTGGAAATATTTCAACATCTCGAGATGTTGAAATATTTCCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017404.2-178s1c1
Sequence:CCGGCGAACGGAGAAGATCGAAGTTCTCGAGAACTTCGATCTTCTCCGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)