EMAIL THIS PAGE TO A FRIEND

MRPL3

mitochondrial ribosomal protein L3

53 Gene Product Result for
Synonyms: COXPD9 MRL3 RPML3
UniProtKB ID: P09001, Q6IBT2
Gene ID:
Human(11222) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L3P ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 13q. [provided by RefSeq, Jul 2008]
Mouse(94062) mitochondrial ribosomal protein L3
Rat(300974) mitochondrial ribosomal protein L3
Zebrafish(336283) mitochondrial ribosomal protein L3
fruit fly(32523) mitochondrial ribosomal protein L3
dog(477067) mitochondrial ribosomal protein L3
Horse(100052750) mitochondrial ribosomal protein L3
cow(614906) mitochondrial ribosomal protein L3
domestic cat(101090962) mitochondrial ribosomal protein L3
chicken(420686) mitochondrial ribosomal protein L3
naked mole-rat(101710105) mitochondrial ribosomal protein L3
domestic guinea pig(100725236) mitochondrial ribosomal protein L3
sheep(101120882) mitochondrial ribosomal protein L3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007208 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007208 Rosetta Predictions human pricing
NM_001106852 Rosetta Predictions rat pricing
NM_053159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230241 predicted 1056
2 SASI_Hs01_00230242 predicted 1102
3 SASI_Hs01_00230243 predicted 940
4 SASI_Hs01_00230244 predicted 1264
5 SASI_Hs01_00230245 predicted 1072
6 SASI_Hs01_00230246 predicted 633
7 SASI_Hs01_00230247 predicted 1182
8 SASI_Hs01_00230248 predicted 439
9 SASI_Hs01_00230249 predicted 1245
10 SASI_Hs01_00230250 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223036 predicted 539
2 SASI_Rn02_00223037 predicted 581
3 SASI_Rn02_00223038 predicted 496
4 SASI_Rn02_00223039 predicted 643
5 SASI_Rn02_00223040 predicted 1004
6 SASI_Rn02_00223041 predicted 277
7 SASI_Rn02_00223042 predicted 1092
8 SASI_Rn02_00223043 predicted 554
9 SASI_Rn02_00223044 predicted 560
10 SASI_Rn02_00223045 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187816 predicted 1136
2 SASI_Mm01_00187817 predicted 961
3 SASI_Mm01_00187818 predicted 547
4 SASI_Mm01_00187819 predicted 943
5 SASI_Mm01_00187820 predicted 368
6 SASI_Mm01_00187821 predicted 692
7 SASI_Mm01_00187822 predicted 1271
8 SASI_Mm02_00337683 predicted 982
9 SASI_Mm01_00187823 predicted 1062
10 SASI_Mm01_00187824 predicted 722
11 SASI_Mm01_00187825 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007208
VALIDATED
MRPL3 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-1184s1c1
Sequence:CCGGCGGTGCGCCTTCTATTACATTCTCGAGAATGTAATAGAAGGCGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007208.2-738s21c1
Sequence:CCGGCCTCTTTATGCTGCTCACTTTCTCGAGAAAGTGAGCAGCATAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-1280s1c1
Sequence:CCGGCCAGAAATCATACTCTCCTTTCTCGAGAAAGGAGAGTATGATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-635s1c1
Sequence:CCGGAGCTACATCCATATTGGAATTCTCGAGAATTCCAATATGGATGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-675s1c1
Sequence:CCGGCCGCCGAAACAGACAGTTAAACTCGAGTTTAACTGTCTGTTTCGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007208.2-738s1c1
Sequence:CCGGCCTCTTTATGCTGCTCACTTTCTCGAGAAAGTGAGCAGCATAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007208.2-675s21c1
Sequence:CCGGCCGCCGAAACAGACAGTTAAACTCGAGTTTAACTGTCTGTTTCGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007208.2-635s21c1
Sequence:CCGGAGCTACATCCATATTGGAATTCTCGAGAATTCCAATATGGATGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007208.2-1280s21c1
Sequence:CCGGCCAGAAATCATACTCTCCTTTCTCGAGAAAGGAGAGTATGATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007208
VALIDATED
MRPL3 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-1184s1c1
Sequence:CCGGCGGTGCGCCTTCTATTACATTCTCGAGAATGTAATAGAAGGCGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007208.2-738s21c1
Sequence:CCGGCCTCTTTATGCTGCTCACTTTCTCGAGAAAGTGAGCAGCATAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-1280s1c1
Sequence:CCGGCCAGAAATCATACTCTCCTTTCTCGAGAAAGGAGAGTATGATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-635s1c1
Sequence:CCGGAGCTACATCCATATTGGAATTCTCGAGAATTCCAATATGGATGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-675s1c1
Sequence:CCGGCCGCCGAAACAGACAGTTAAACTCGAGTTTAACTGTCTGTTTCGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007208.2-738s1c1
Sequence:CCGGCCTCTTTATGCTGCTCACTTTCTCGAGAAAGTGAGCAGCATAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007208.2-675s21c1
Sequence:CCGGCCGCCGAAACAGACAGTTAAACTCGAGTTTAACTGTCTGTTTCGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007208.2-635s21c1
Sequence:CCGGAGCTACATCCATATTGGAATTCTCGAGAATTCCAATATGGATGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007208.2-1280s21c1
Sequence:CCGGCCAGAAATCATACTCTCCTTTCTCGAGAAAGGAGAGTATGATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007208
VALIDATED
MRPL3 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-1184s1c1
Sequence:CCGGCGGTGCGCCTTCTATTACATTCTCGAGAATGTAATAGAAGGCGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007208.2-738s21c1
Sequence:CCGGCCTCTTTATGCTGCTCACTTTCTCGAGAAAGTGAGCAGCATAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-1280s1c1
Sequence:CCGGCCAGAAATCATACTCTCCTTTCTCGAGAAAGGAGAGTATGATTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-635s1c1
Sequence:CCGGAGCTACATCCATATTGGAATTCTCGAGAATTCCAATATGGATGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007208.2-675s1c1
Sequence:CCGGCCGCCGAAACAGACAGTTAAACTCGAGTTTAACTGTCTGTTTCGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007208.2-738s1c1
Sequence:CCGGCCTCTTTATGCTGCTCACTTTCTCGAGAAAGTGAGCAGCATAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007208.2-675s21c1
Sequence:CCGGCCGCCGAAACAGACAGTTAAACTCGAGTTTAACTGTCTGTTTCGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007208.2-635s21c1
Sequence:CCGGAGCTACATCCATATTGGAATTCTCGAGAATTCCAATATGGATGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007208.2-1280s21c1
Sequence:CCGGCCAGAAATCATACTCTCCTTTCTCGAGAAAGGAGAGTATGATTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053159
VALIDATED
MRPL3 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053159.2-1364s1c1
Sequence:CCGGGCATTAAACAAACAGTCGCATCTCGAGATGCGACTGTTTGTTTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-837s1c1
Sequence:CCGGTGCTTCTCATGGTCAAACAAACTCGAGTTTGTTTGACCATGAGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-614s1c1
Sequence:CCGGGCTTCTATAAACCTGACTCTACTCGAGTAGAGTCAGGTTTATAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-505s1c1
Sequence:CCGGGCAGTCACATTACTACAGGTACTCGAGTACCTGTAGTAATGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-726s1c1
Sequence:CCGGCCCTCTTTATGCAGCTCACTTCTCGAGAAGTGAGCTGCATAAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-505s21c1
Sequence:CCGGGCAGTCACATTACTACAGGTACTCGAGTACCTGTAGTAATGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-1342s21c1
Sequence:CCGGCAGCCTGGTTAGCAAGGTTACCTCGAGGTAACCTTGCTAACCAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-980s21c1
Sequence:CCGGTGAACACCAAGCACAACATAACTCGAGTTATGTTGTGCTTGGTGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053159.3-726s21c1
Sequence:CCGGCCCTCTTTATGCAGCTCACTTCTCGAGAAGTGAGCTGCATAAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-614s21c1
Sequence:CCGGGCTTCTATAAACCTGACTCTACTCGAGTAGAGTCAGGTTTATAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053159
VALIDATED
MRPL3 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053159.2-1364s1c1
Sequence:CCGGGCATTAAACAAACAGTCGCATCTCGAGATGCGACTGTTTGTTTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-837s1c1
Sequence:CCGGTGCTTCTCATGGTCAAACAAACTCGAGTTTGTTTGACCATGAGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-614s1c1
Sequence:CCGGGCTTCTATAAACCTGACTCTACTCGAGTAGAGTCAGGTTTATAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-505s1c1
Sequence:CCGGGCAGTCACATTACTACAGGTACTCGAGTACCTGTAGTAATGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-726s1c1
Sequence:CCGGCCCTCTTTATGCAGCTCACTTCTCGAGAAGTGAGCTGCATAAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-505s21c1
Sequence:CCGGGCAGTCACATTACTACAGGTACTCGAGTACCTGTAGTAATGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-1342s21c1
Sequence:CCGGCAGCCTGGTTAGCAAGGTTACCTCGAGGTAACCTTGCTAACCAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-980s21c1
Sequence:CCGGTGAACACCAAGCACAACATAACTCGAGTTATGTTGTGCTTGGTGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053159.3-726s21c1
Sequence:CCGGCCCTCTTTATGCAGCTCACTTCTCGAGAAGTGAGCTGCATAAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-614s21c1
Sequence:CCGGGCTTCTATAAACCTGACTCTACTCGAGTAGAGTCAGGTTTATAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053159
VALIDATED
MRPL3 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053159.2-1364s1c1
Sequence:CCGGGCATTAAACAAACAGTCGCATCTCGAGATGCGACTGTTTGTTTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-837s1c1
Sequence:CCGGTGCTTCTCATGGTCAAACAAACTCGAGTTTGTTTGACCATGAGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-614s1c1
Sequence:CCGGGCTTCTATAAACCTGACTCTACTCGAGTAGAGTCAGGTTTATAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-505s1c1
Sequence:CCGGGCAGTCACATTACTACAGGTACTCGAGTACCTGTAGTAATGTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053159.2-726s1c1
Sequence:CCGGCCCTCTTTATGCAGCTCACTTCTCGAGAAGTGAGCTGCATAAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-505s21c1
Sequence:CCGGGCAGTCACATTACTACAGGTACTCGAGTACCTGTAGTAATGTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-1342s21c1
Sequence:CCGGCAGCCTGGTTAGCAAGGTTACCTCGAGGTAACCTTGCTAACCAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-980s21c1
Sequence:CCGGTGAACACCAAGCACAACATAACTCGAGTTATGTTGTGCTTGGTGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053159.3-726s21c1
Sequence:CCGGCCCTCTTTATGCAGCTCACTTCTCGAGAAGTGAGCTGCATAAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053159.3-614s21c1
Sequence:CCGGGCTTCTATAAACCTGACTCTACTCGAGTAGAGTCAGGTTTATAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)