EMAIL THIS PAGE TO A FRIEND

MRPL41

mitochondrial ribosomal protein L41

72 Gene Product Result for
Synonyms: BMRP MRP-L27 MRPL27 RPML27
UniProtKB ID: Q8IXM3, Q96Q49
Gene ID:
Human(64975) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the YmL27 ribosomal protein family. [provided by RefSeq, Jul 2008]
Mouse(107733) mitochondrial ribosomal protein L41
Rat(296551) mitochondrial ribosomal protein L41
Zebrafish(553805) mitochondrial ribosomal protein L41
cow(506521) mitochondrial ribosomal protein L41
domestic cat(101086353) mitochondrial ribosomal protein L41
dog(491225) mitochondrial ribosomal protein L41
chicken(417261) mitochondrial ribosomal protein L41
fruit fly(36688) mitochondrial ribosomal protein L41
naked mole-rat(101703243) mitochondrial ribosomal protein L41
domestic guinea pig(100727134) mitochondrial ribosomal protein L41
sheep(101108465) mitochondrial ribosomal protein L41
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001031808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001031808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032477 Rosetta Predictions human pricing
NM_001013426 Rosetta Predictions rat pricing
NM_001031808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124054 predicted 230
2 SASI_Hs02_00359927 predicted 237
3 SASI_Hs02_00359928 predicted 241
4 SASI_Hs01_00124053 predicted 295
5 SASI_Hs02_00359929 predicted 318
6 SASI_Hs01_00124055 predicted 249
7 SASI_Hs01_00124056 predicted 303
8 SASI_Hs01_00124057 predicted 273
9 SASI_Hs01_00124059 predicted 310
10 SASI_Hs01_00124060 predicted 318
11 SASI_Hs01_00124052 predicted 240
12 SASI_Hs01_00124058 predicted 238
13 SASI_Hs01_00124061 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111790 predicted 333
2 SASI_Rn01_00111791 predicted 241
3 SASI_Rn01_00111792 predicted 364
4 SASI_Rn02_00201091 predicted 246
5 SASI_Rn01_00111794 predicted 208
6 SASI_Rn01_00111796 predicted 437
7 SASI_Rn01_00111797 predicted 382
8 SASI_Rn01_00111798 predicted 407
9 SASI_Rn02_00201092 predicted 440
10 SASI_Rn02_00201093 predicted 360
11 SASI_Rn01_00111793 predicted 392
12 SASI_Rn01_00111795 predicted 284
13 SASI_Rn01_00111799 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110378 predicted 740
2 SASI_Mm02_00288157 predicted 507
3 SASI_Mm01_00110381 predicted 684
4 SASI_Mm01_00110382 predicted 634
5 SASI_Mm01_00110384 predicted 753
6 SASI_Mm02_00288158 predicted 705
7 SASI_Mm01_00110386 predicted 816
8 SASI_Mm01_00110385 predicted 539
9 SASI_Mm01_00110387 predicted 824
10 SASI_Mm02_00288159 predicted 822
11 SASI_Mm01_00110379 predicted 707
12 SASI_Mm01_00110380 predicted 517
13 SASI_Mm01_00110383 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031808
MRPL41 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L41
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-1162s21c1
Sequence:CCGGCCAAGTTAAGCCCATACTTATCTCGAGATAAGTATGGGCTTAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-991s21c1
Sequence:CCGGCCAGTCTAGTCTACCTGATTCCTCGAGGAATCAGGTAGACTAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-1285s21c1
Sequence:CCGGCAAGACAGGCTATCGTGAATGCTCGAGCATTCACGATAGCCTGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-833s21c1
Sequence:CCGGGCTATAGAGTTCATAACAAATCTCGAGATTTGTTATGAACTCTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-1047s21c1
Sequence:CCGGGACTTAGCTAACCCTTATATTCTCGAGAATATAAGGGTTAGCTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031808
MRPL41 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L41
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-1162s21c1
Sequence:CCGGCCAAGTTAAGCCCATACTTATCTCGAGATAAGTATGGGCTTAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-991s21c1
Sequence:CCGGCCAGTCTAGTCTACCTGATTCCTCGAGGAATCAGGTAGACTAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-1285s21c1
Sequence:CCGGCAAGACAGGCTATCGTGAATGCTCGAGCATTCACGATAGCCTGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-833s21c1
Sequence:CCGGGCTATAGAGTTCATAACAAATCTCGAGATTTGTTATGAACTCTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-1047s21c1
Sequence:CCGGGACTTAGCTAACCCTTATATTCTCGAGAATATAAGGGTTAGCTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031808
MRPL41 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L41
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-1162s21c1
Sequence:CCGGCCAAGTTAAGCCCATACTTATCTCGAGATAAGTATGGGCTTAACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-991s21c1
Sequence:CCGGCCAGTCTAGTCTACCTGATTCCTCGAGGAATCAGGTAGACTAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-1285s21c1
Sequence:CCGGCAAGACAGGCTATCGTGAATGCTCGAGCATTCACGATAGCCTGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-833s21c1
Sequence:CCGGGCTATAGAGTTCATAACAAATCTCGAGATTTGTTATGAACTCTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031808.2-1047s21c1
Sequence:CCGGGACTTAGCTAACCCTTATATTCTCGAGAATATAAGGGTTAGCTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032477
VALIDATED
MRPL41 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L41
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-182s21c1
Sequence:CCGGATGAGCAAGTGGACGAGCAAGCTCGAGCTTGCTCGTCCACTTGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032477.2-333s21c1
Sequence:CCGGTCAAGCTCAAGCCCTACGTGACTCGAGTCACGTAGGGCTTGAGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-271s21c1
Sequence:CCGGCTGGAGGTTCGTGCAGATCAACTCGAGTTGATCTGCACGAACCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-322s21c1
Sequence:CCGGTCTGACCGGCTTCAAGCTCAACTCGAGTTGAGCTTGAAGCCGGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-456s21c1
Sequence:CCGGTCGACCCTGACAACCTGGAAACTCGAGTTTCCAGGTTGTCAGGGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032477
VALIDATED
MRPL41 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L41
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-182s21c1
Sequence:CCGGATGAGCAAGTGGACGAGCAAGCTCGAGCTTGCTCGTCCACTTGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032477.2-333s21c1
Sequence:CCGGTCAAGCTCAAGCCCTACGTGACTCGAGTCACGTAGGGCTTGAGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-271s21c1
Sequence:CCGGCTGGAGGTTCGTGCAGATCAACTCGAGTTGATCTGCACGAACCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-322s21c1
Sequence:CCGGTCTGACCGGCTTCAAGCTCAACTCGAGTTGAGCTTGAAGCCGGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-456s21c1
Sequence:CCGGTCGACCCTGACAACCTGGAAACTCGAGTTTCCAGGTTGTCAGGGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032477
VALIDATED
MRPL41 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L41
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-182s21c1
Sequence:CCGGATGAGCAAGTGGACGAGCAAGCTCGAGCTTGCTCGTCCACTTGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032477.2-333s21c1
Sequence:CCGGTCAAGCTCAAGCCCTACGTGACTCGAGTCACGTAGGGCTTGAGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-271s21c1
Sequence:CCGGCTGGAGGTTCGTGCAGATCAACTCGAGTTGATCTGCACGAACCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-322s21c1
Sequence:CCGGTCTGACCGGCTTCAAGCTCAACTCGAGTTGAGCTTGAAGCCGGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032477.2-456s21c1
Sequence:CCGGTCGACCCTGACAACCTGGAAACTCGAGTTTCCAGGTTGTCAGGGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)