EMAIL THIS PAGE TO A FRIEND

MRPL42

mitochondrial ribosomal protein L42

101 Gene Product Result for
Synonyms: L31MT L42MT MRP-L31 MRP-L42 MRP-S32 MRPL31 MRPS32 PTD007 RPML31 S32MT
UniProtKB ID: Q9Y6G3, Q6FID1, Q96Q48, Q9P0S1
Gene ID:
Human(28977) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a protein identified as belonging to both the 28S and the 39S subunits. Alternative splicing results in multiple transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 4q, 6p, 6q, 7p, and 15q. [provided by RefSeq, May 2011]
Mouse(67270) mitochondrial ribosomal protein L42
Rat(299743) mitochondrial ribosomal protein L42
sheep(101114257) mitochondrial ribosomal protein L42
domestic guinea pig(100726140) mitochondrial ribosomal protein L42
naked mole-rat(101717844) mitochondrial ribosomal protein L42
fruit fly(36050) mitochondrial ribosomal protein L42
chicken(417899) mitochondrial ribosomal protein L42
domestic cat(101089532) mitochondrial ribosomal protein L42
cow(614148) mitochondrial ribosomal protein L42
dog(475426) mitochondrial ribosomal protein L42
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014050 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014050 Rosetta Predictions human pricing
NM_172177 Rosetta Predictions human pricing
NM_172178 Rosetta Predictions human pricing
NM_001106782 Rosetta Predictions rat pricing
NM_026065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119915 predicted 464
2 SASI_Hs01_00119916 predicted 467
3 SASI_Hs01_00119920 predicted 467
4 SASI_Hs02_00345060 predicted 507
5 SASI_Hs02_00345061 predicted 464
6 SASI_Hs01_00119917 predicted 534
7 SASI_Hs01_00119919 predicted 529
8 SASI_Hs02_00345062 predicted 724
9 SASI_Hs01_00119923 predicted 731
10 SASI_Hs01_00119924 predicted 225
11 SASI_Hs01_00119918 predicted 484
12 SASI_Hs01_00119921 predicted 648
13 SASI_Hs01_00119922 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243110 predicted 462
2 SASI_Hs01_00243111 predicted 468
3 SASI_Hs01_00243115 predicted 466
4 SASI_Hs02_00367879 predicted 513
5 SASI_Hs02_00367880 predicted 461
6 SASI_Hs01_00243112 predicted 530
7 SASI_Hs01_00243114 predicted 540
8 SASI_Hs02_00367881 predicted 735
9 SASI_Hs01_00243118 predicted 738
10 SASI_Hs01_00243119 predicted 224
11 SASI_Hs01_00243113 predicted 477
12 SASI_Hs01_00243116 predicted 644
13 SASI_Hs01_00243117 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117548 predicted 489
2 SASI_Hs01_00117549 predicted 490
3 SASI_Hs01_00117553 predicted 492
4 SASI_Hs02_00367882 predicted 528
5 SASI_Hs02_00367883 predicted 487
6 SASI_Hs01_00117550 predicted 555
7 SASI_Hs01_00117552 predicted 554
8 SASI_Hs02_00367884 predicted 755
9 SASI_Hs01_00117555 predicted 755
10 SASI_Hs02_00367885 predicted 315
11 SASI_Hs01_00117551 predicted 503
12 SASI_Hs01_00117554 predicted 411
13 SASI_Hs01_00117556 predicted 249
14 SASI_Hs01_00117557 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222348 predicted 209
2 SASI_Rn02_00222349 predicted 428
3 SASI_Rn02_00222350 predicted 262
4 SASI_Rn02_00222351 predicted 256
5 SASI_Rn02_00222352 predicted 338
6 SASI_Rn02_00222353 predicted 258
7 SASI_Rn02_00222354 predicted 213
8 SASI_Rn02_00222355 predicted 201
9 SASI_Rn02_00222356 predicted 254
10 SASI_Rn02_00222357 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197083 predicted 310
2 SASI_Mm01_00197084 predicted 314
3 SASI_Mm01_00197085 predicted 321
4 SASI_Mm01_00197086 predicted 530
5 SASI_Mm01_00197087 predicted 524
6 SASI_Mm01_00197089 predicted 503
7 SASI_Mm01_00197088 predicted 509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014050
VALIDATED
MRPL42 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L42
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014050.2-998s21c1
Sequence:CCGGTTCAACTGATAGTAGGTTTATCTCGAGATAAACCTACTATCAGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014050.2-1394s1c1
Sequence:CCGGGCCAAACTATCAGGCTCCAAACTCGAGTTTGGAGCCTGATAGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014050.2-1871s1c1
Sequence:CCGGGCCAGTGAAGTGTGAGGAATACTCGAGTATTCCTCACACTTCACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014050.2-468s1c1
Sequence:CCGGGAAGGACCTATGATAGAACAACTCGAGTTGTTCTATCATAGGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-387s21c1
Sequence:CCGGCCAGATCCTGTGCATAATAATCTCGAGATTATTATGCACAGGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-245s21c1
Sequence:CCGGTTGTCATAAATCTACGTATTCCTCGAGGAATACGTAGATTTATGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014050.2-801s21c1
Sequence:CCGGTATGTGCGGTCTCCAATTTAGCTCGAGCTAAATTGGAGACCGCACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-267s21c1
Sequence:CCGGCCTCTACCAGATGACTATAATCTCGAGATTATAGTCATCTGGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014050.2-1098s21c1
Sequence:CCGGCAAGCATTGTTAGTAGTATAACTCGAGTTATACTACTAACAATGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014050.2-1287s1c1
Sequence:CCGGCCCTTCCATCAATTCTTATTACTCGAGTAATAAGAATTGATGGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-185s21c1
Sequence:CCGGGTCAAAGAGAACTATCTTGAACTCGAGTTCAAGATAGTTCTCTTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-309s21c1
Sequence:CCGGACTTCTGATGGCAGGACAATACTCGAGTATTGTCCTGCCATCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014050.2-545s1c1
Sequence:CCGGCAGATGTCGTAAGAATCTGAACTCGAGTTCAGATTCTTACGACATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014050.2-297s1c1
Sequence:CCGGGAGCTTGCTCTGACTTCTGATCTCGAGATCAGAAGTCAGAGCAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_014050.2-472s1c1
Sequence:CCGGGACCTATGATAGAACAACTTACTCGAGTAAGTTGTTCTATCATAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014050.2-185s1c1
Sequence:CCGGGTCAAAGAGAACTATCTTGAACTCGAGTTCAAGATAGTTCTCTTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014050
VALIDATED
MRPL42 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L42
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014050.2-998s21c1
Sequence:CCGGTTCAACTGATAGTAGGTTTATCTCGAGATAAACCTACTATCAGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014050.2-1394s1c1
Sequence:CCGGGCCAAACTATCAGGCTCCAAACTCGAGTTTGGAGCCTGATAGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014050.2-1871s1c1
Sequence:CCGGGCCAGTGAAGTGTGAGGAATACTCGAGTATTCCTCACACTTCACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014050.2-468s1c1
Sequence:CCGGGAAGGACCTATGATAGAACAACTCGAGTTGTTCTATCATAGGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-387s21c1
Sequence:CCGGCCAGATCCTGTGCATAATAATCTCGAGATTATTATGCACAGGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-245s21c1
Sequence:CCGGTTGTCATAAATCTACGTATTCCTCGAGGAATACGTAGATTTATGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014050.2-801s21c1
Sequence:CCGGTATGTGCGGTCTCCAATTTAGCTCGAGCTAAATTGGAGACCGCACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-267s21c1
Sequence:CCGGCCTCTACCAGATGACTATAATCTCGAGATTATAGTCATCTGGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014050.2-1098s21c1
Sequence:CCGGCAAGCATTGTTAGTAGTATAACTCGAGTTATACTACTAACAATGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014050.2-1287s1c1
Sequence:CCGGCCCTTCCATCAATTCTTATTACTCGAGTAATAAGAATTGATGGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-185s21c1
Sequence:CCGGGTCAAAGAGAACTATCTTGAACTCGAGTTCAAGATAGTTCTCTTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-309s21c1
Sequence:CCGGACTTCTGATGGCAGGACAATACTCGAGTATTGTCCTGCCATCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014050.2-545s1c1
Sequence:CCGGCAGATGTCGTAAGAATCTGAACTCGAGTTCAGATTCTTACGACATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014050.2-297s1c1
Sequence:CCGGGAGCTTGCTCTGACTTCTGATCTCGAGATCAGAAGTCAGAGCAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_014050.2-472s1c1
Sequence:CCGGGACCTATGATAGAACAACTTACTCGAGTAAGTTGTTCTATCATAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014050.2-185s1c1
Sequence:CCGGGTCAAAGAGAACTATCTTGAACTCGAGTTCAAGATAGTTCTCTTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014050
VALIDATED
MRPL42 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L42
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014050.2-998s21c1
Sequence:CCGGTTCAACTGATAGTAGGTTTATCTCGAGATAAACCTACTATCAGTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014050.2-1394s1c1
Sequence:CCGGGCCAAACTATCAGGCTCCAAACTCGAGTTTGGAGCCTGATAGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014050.2-1871s1c1
Sequence:CCGGGCCAGTGAAGTGTGAGGAATACTCGAGTATTCCTCACACTTCACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014050.2-468s1c1
Sequence:CCGGGAAGGACCTATGATAGAACAACTCGAGTTGTTCTATCATAGGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-387s21c1
Sequence:CCGGCCAGATCCTGTGCATAATAATCTCGAGATTATTATGCACAGGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-245s21c1
Sequence:CCGGTTGTCATAAATCTACGTATTCCTCGAGGAATACGTAGATTTATGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014050.2-801s21c1
Sequence:CCGGTATGTGCGGTCTCCAATTTAGCTCGAGCTAAATTGGAGACCGCACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-267s21c1
Sequence:CCGGCCTCTACCAGATGACTATAATCTCGAGATTATAGTCATCTGGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014050.2-1098s21c1
Sequence:CCGGCAAGCATTGTTAGTAGTATAACTCGAGTTATACTACTAACAATGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014050.2-1287s1c1
Sequence:CCGGCCCTTCCATCAATTCTTATTACTCGAGTAATAAGAATTGATGGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-185s21c1
Sequence:CCGGGTCAAAGAGAACTATCTTGAACTCGAGTTCAAGATAGTTCTCTTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014050.2-309s21c1
Sequence:CCGGACTTCTGATGGCAGGACAATACTCGAGTATTGTCCTGCCATCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014050.2-545s1c1
Sequence:CCGGCAGATGTCGTAAGAATCTGAACTCGAGTTCAGATTCTTACGACATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014050.2-297s1c1
Sequence:CCGGGAGCTTGCTCTGACTTCTGATCTCGAGATCAGAAGTCAGAGCAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_014050.2-472s1c1
Sequence:CCGGGACCTATGATAGAACAACTTACTCGAGTAAGTTGTTCTATCATAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014050.2-185s1c1
Sequence:CCGGGTCAAAGAGAACTATCTTGAACTCGAGTTCAAGATAGTTCTCTTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026065
VALIDATED
MRPL42 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L42
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-312s21c1
Sequence:CCGGCTACGAACACACCAAACCCATCTCGAGATGGGTTTGGTGTGTTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-144s21c1
Sequence:CCGGCAGAACTATCTGGAAGCATTTCTCGAGAAATGCTTCCAGATAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-375s21c1
Sequence:CCGGGCAGATCCTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCAGGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-340s21c1
Sequence:CCGGCCAGATCTTCTGCATAATAATCTCGAGATTATTATGCAGAAGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-492s21c1
Sequence:CCGGACAGTATCACAATCGTCGTAACTCGAGTTACGACGATTGTGATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026065.2-145s1c1
Sequence:CCGGCAGAACTATCTGGAAGCATTTCTCGAGAAATGCTTCCAGATAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026065.2-493s1c1
Sequence:CCGGACAGTATCACAATCGTCGTAACTCGAGTTACGACGATTGTGATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026065.2-341s1c1
Sequence:CCGGCCAGATCTTCTGCATAATAATCTCGAGATTATTATGCAGAAGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026065.2-376s1c1
Sequence:CCGGGCAGATCCTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCAGGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026065.2-313s1c1
Sequence:CCGGCTACGAACACACCAAACCCATCTCGAGATGGGTTTGGTGTGTTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026065
VALIDATED
MRPL42 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L42
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-312s21c1
Sequence:CCGGCTACGAACACACCAAACCCATCTCGAGATGGGTTTGGTGTGTTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-144s21c1
Sequence:CCGGCAGAACTATCTGGAAGCATTTCTCGAGAAATGCTTCCAGATAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-375s21c1
Sequence:CCGGGCAGATCCTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCAGGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-340s21c1
Sequence:CCGGCCAGATCTTCTGCATAATAATCTCGAGATTATTATGCAGAAGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-492s21c1
Sequence:CCGGACAGTATCACAATCGTCGTAACTCGAGTTACGACGATTGTGATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026065.2-145s1c1
Sequence:CCGGCAGAACTATCTGGAAGCATTTCTCGAGAAATGCTTCCAGATAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026065.2-493s1c1
Sequence:CCGGACAGTATCACAATCGTCGTAACTCGAGTTACGACGATTGTGATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026065.2-341s1c1
Sequence:CCGGCCAGATCTTCTGCATAATAATCTCGAGATTATTATGCAGAAGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026065.2-376s1c1
Sequence:CCGGGCAGATCCTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCAGGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026065.2-313s1c1
Sequence:CCGGCTACGAACACACCAAACCCATCTCGAGATGGGTTTGGTGTGTTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026065
VALIDATED
MRPL42 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L42
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-312s21c1
Sequence:CCGGCTACGAACACACCAAACCCATCTCGAGATGGGTTTGGTGTGTTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-144s21c1
Sequence:CCGGCAGAACTATCTGGAAGCATTTCTCGAGAAATGCTTCCAGATAGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-375s21c1
Sequence:CCGGGCAGATCCTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCAGGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-340s21c1
Sequence:CCGGCCAGATCTTCTGCATAATAATCTCGAGATTATTATGCAGAAGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026065.3-492s21c1
Sequence:CCGGACAGTATCACAATCGTCGTAACTCGAGTTACGACGATTGTGATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026065.2-145s1c1
Sequence:CCGGCAGAACTATCTGGAAGCATTTCTCGAGAAATGCTTCCAGATAGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026065.2-493s1c1
Sequence:CCGGACAGTATCACAATCGTCGTAACTCGAGTTACGACGATTGTGATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026065.2-341s1c1
Sequence:CCGGCCAGATCTTCTGCATAATAATCTCGAGATTATTATGCAGAAGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026065.2-376s1c1
Sequence:CCGGGCAGATCCTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCAGGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026065.2-313s1c1
Sequence:CCGGCTACGAACACACCAAACCCATCTCGAGATGGGTTTGGTGTGTTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)