EMAIL THIS PAGE TO A FRIEND

MRPL44

mitochondrial ribosomal protein L44

63 Gene Product Result for
Synonyms: COXPD16 L44MT MRP-L44
UniProtKB ID: Q9H9J2, Q53S16, Q6IA62, Q9H821
Gene ID:
Human(65080) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(69163) mitochondrial ribosomal protein L44
Rat(301552) mitochondrial ribosomal protein L44
sheep(101121751) mitochondrial ribosomal protein L44
domestic guinea pig(100718366) mitochondrial ribosomal protein L44
naked mole-rat(101698069) mitochondrial ribosomal protein L44
Zebrafish(571210) mitochondrial ribosomal protein L44
fruit fly(40656) mitochondrial ribosomal protein L44
cow(532389) mitochondrial ribosomal protein L44
domestic cat(101085231) mitochondrial ribosomal protein L44
dog(100683659) mitochondrial ribosomal protein L44
chicken(424795) mitochondrial ribosomal protein L44
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022915 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022915 Rosetta Predictions human pricing
NM_001031650 Rosetta Predictions rat pricing
NM_001081210 Rosetta Predictions mouse pricing
XM_357108 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115079 predicted 594
2 SASI_Hs02_00356240 predicted 1023
3 SASI_Hs01_00115081 predicted 1006
4 SASI_Hs01_00115082 predicted 332
5 SASI_Hs02_00356241 predicted 931
6 SASI_Hs01_00115083 predicted 477
7 SASI_Hs01_00115085 predicted 376
8 SASI_Hs02_00356242 predicted 263
9 SASI_Hs02_00356243 predicted 481
10 SASI_Hs02_00356244 predicted 1013
11 SASI_Hs01_00115078 predicted 971
12 SASI_Hs01_00115080 predicted 627
13 SASI_Hs01_00115084 predicted 330
14 SASI_Hs01_00115086 predicted 802
15 SASI_Hs01_00115087 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070300 predicted 697
2 SASI_Rn01_00070301 predicted 215
3 SASI_Rn01_00070303 predicted 470
4 SASI_Rn01_00070304 predicted 490
5 SASI_Rn02_00203592 predicted 312
6 SASI_Rn01_00070305 predicted 643
7 SASI_Rn01_00070306 predicted 325
8 SASI_Rn01_00070307 predicted 579
9 SASI_Rn01_00070309 predicted 199
10 SASI_Rn02_00203593 predicted 906
11 SASI_Rn01_00070302 predicted 694
12 SASI_Rn01_00070308 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296261 predicted 582
2 SASI_Mm02_00296262 predicted 810
3 SASI_Mm02_00296263 predicted 739
4 SASI_Mm02_00296264 predicted 676
5 SASI_Mm02_00296265 predicted 801
6 SASI_Mm02_00296266 predicted 903
7 SASI_Mm02_00296267 predicted 407
8 SASI_Mm02_00296268 predicted 303
9 SASI_Mm02_00296269 predicted 553
10 SASI_Mm02_00296270 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245931 predicted 592
2 SASI_Mm01_00245932 predicted 430
3 SASI_Mm01_00245933 predicted 809
4 SASI_Mm01_00245934 predicted 746
5 SASI_Mm01_00245935 predicted 682
6 SASI_Mm01_00245936 predicted 804
7 SASI_Mm01_00245937 predicted 899
8 SASI_Mm01_00245938 predicted 412
9 SASI_Mm01_00245939 predicted 316
10 SASI_Mm01_00245940 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022915
VALIDATED
MRPL44 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L44
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-634s21c1
Sequence:CCGGGCTGTGTTACAGCAGACTTTCCTCGAGGAAAGTCTGCTGTAACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-382s21c1
Sequence:CCGGCGCCAACAACTTGGGATAGAGCTCGAGCTCTATCCCAAGTTGTTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022915.3-1246s21c1
Sequence:CCGGTGAAATCTTGGTTTGATCAAACTCGAGTTTGATCAAACCAAGATTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-444s21c1
Sequence:CCGGATCCGAACAAGGGACATCTTTCTCGAGAAAGATGTCCCTTGTTCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-584s21c1
Sequence:CCGGACTTGGCTGTGGAGCAGTTAACTCGAGTTAACTGCTCCACAGCCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-718s21c1
Sequence:CCGGGACTTCTTAATTACTCAAATGCTCGAGCATTTGAGTAATTAAGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022915.2-645s1c1
Sequence:CCGGGCAGTTATTGGAGCCCTGTTACTCGAGTAACAGGGCTCCAATAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022915.3-1123s21c1
Sequence:CCCGAGGTGTTTCAAGCCAGACATTCTCGAGAATGTCTGGCTTGAAACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022915.2-737s1c1
Sequence:CCGGGCTCTTTGAGATGTGGAAGATCTCGAGATCTTCCACATCTCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022915.2-995s1c1
Sequence:CCGGGTGGAACTATTCCAAGCCCAACTCGAGTTGGGCTTGGAATAGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_022915.2-326s1c1
Sequence:CCGGTGCATTTGTTAATAGCTGCTACTCGAGTAGCAGCTATTAACAAATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022915.2-808s1c1
Sequence:CCGGCAGCTCCTGAATCAAGACTTACTCGAGTAAGTCTTGATTCAGGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022915
VALIDATED
MRPL44 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L44
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-634s21c1
Sequence:CCGGGCTGTGTTACAGCAGACTTTCCTCGAGGAAAGTCTGCTGTAACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-382s21c1
Sequence:CCGGCGCCAACAACTTGGGATAGAGCTCGAGCTCTATCCCAAGTTGTTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022915.3-1246s21c1
Sequence:CCGGTGAAATCTTGGTTTGATCAAACTCGAGTTTGATCAAACCAAGATTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-444s21c1
Sequence:CCGGATCCGAACAAGGGACATCTTTCTCGAGAAAGATGTCCCTTGTTCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-584s21c1
Sequence:CCGGACTTGGCTGTGGAGCAGTTAACTCGAGTTAACTGCTCCACAGCCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-718s21c1
Sequence:CCGGGACTTCTTAATTACTCAAATGCTCGAGCATTTGAGTAATTAAGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022915.2-645s1c1
Sequence:CCGGGCAGTTATTGGAGCCCTGTTACTCGAGTAACAGGGCTCCAATAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022915.3-1123s21c1
Sequence:CCCGAGGTGTTTCAAGCCAGACATTCTCGAGAATGTCTGGCTTGAAACACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022915.2-737s1c1
Sequence:CCGGGCTCTTTGAGATGTGGAAGATCTCGAGATCTTCCACATCTCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022915.2-995s1c1
Sequence:CCGGGTGGAACTATTCCAAGCCCAACTCGAGTTGGGCTTGGAATAGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_022915.2-326s1c1
Sequence:CCGGTGCATTTGTTAATAGCTGCTACTCGAGTAGCAGCTATTAACAAATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022915.2-808s1c1
Sequence:CCGGCAGCTCCTGAATCAAGACTTACTCGAGTAAGTCTTGATTCAGGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022915
VALIDATED
MRPL44 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L44
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-634s21c1
Sequence:CCGGGCTGTGTTACAGCAGACTTTCCTCGAGGAAAGTCTGCTGTAACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-382s21c1
Sequence:CCGGCGCCAACAACTTGGGATAGAGCTCGAGCTCTATCCCAAGTTGTTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022915.3-1246s21c1
Sequence:CCGGTGAAATCTTGGTTTGATCAAACTCGAGTTTGATCAAACCAAGATTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-444s21c1
Sequence:CCGGATCCGAACAAGGGACATCTTTCTCGAGAAAGATGTCCCTTGTTCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-584s21c1
Sequence:CCGGACTTGGCTGTGGAGCAGTTAACTCGAGTTAACTGCTCCACAGCCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022915.3-718s21c1
Sequence:CCGGGACTTCTTAATTACTCAAATGCTCGAGCATTTGAGTAATTAAGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022915.2-645s1c1
Sequence:CCGGGCAGTTATTGGAGCCCTGTTACTCGAGTAACAGGGCTCCAATAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022915.3-1123s21c1
Sequence:CCCGAGGTGTTTCAAGCCAGACATTCTCGAGAATGTCTGGCTTGAAACACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022915.2-737s1c1
Sequence:CCGGGCTCTTTGAGATGTGGAAGATCTCGAGATCTTCCACATCTCAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022915.2-995s1c1
Sequence:CCGGGTGGAACTATTCCAAGCCCAACTCGAGTTGGGCTTGGAATAGTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_022915.2-326s1c1
Sequence:CCGGTGCATTTGTTAATAGCTGCTACTCGAGTAGCAGCTATTAACAAATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022915.2-808s1c1
Sequence:CCGGCAGCTCCTGAATCAAGACTTACTCGAGTAAGTCTTGATTCAGGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081210
VALIDATED
MRPL44 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-693s21c1
Sequence:CCGGAGACTTTCTTCGCGGTCATTGCTCGAGCAATGACCGCGAAGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-1253s21c1
Sequence:CCGGCAGGTGACAGGGATTTGTTTCCTCGAGGAAACAAATCCCTGTCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-804s21c1
Sequence:CCGGAGATGTGGACCGTCGTAAATCCTCGAGGATTTACGACGGTCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-568s21c1
Sequence:CCGGAGGCACTGAGAGTCTAGTTAGCTCGAGCTAACTAGACTCTCAGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-904s21c1
Sequence:CCGGCACAACTGCTCTGCCTTTATACTCGAGTATAAAGGCAGAGCAGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081210
VALIDATED
MRPL44 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-693s21c1
Sequence:CCGGAGACTTTCTTCGCGGTCATTGCTCGAGCAATGACCGCGAAGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-1253s21c1
Sequence:CCGGCAGGTGACAGGGATTTGTTTCCTCGAGGAAACAAATCCCTGTCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-804s21c1
Sequence:CCGGAGATGTGGACCGTCGTAAATCCTCGAGGATTTACGACGGTCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-568s21c1
Sequence:CCGGAGGCACTGAGAGTCTAGTTAGCTCGAGCTAACTAGACTCTCAGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-904s21c1
Sequence:CCGGCACAACTGCTCTGCCTTTATACTCGAGTATAAAGGCAGAGCAGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081210
VALIDATED
MRPL44 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-693s21c1
Sequence:CCGGAGACTTTCTTCGCGGTCATTGCTCGAGCAATGACCGCGAAGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-1253s21c1
Sequence:CCGGCAGGTGACAGGGATTTGTTTCCTCGAGGAAACAAATCCCTGTCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-804s21c1
Sequence:CCGGAGATGTGGACCGTCGTAAATCCTCGAGGATTTACGACGGTCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-568s21c1
Sequence:CCGGAGGCACTGAGAGTCTAGTTAGCTCGAGCTAACTAGACTCTCAGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081210.1-904s21c1
Sequence:CCGGCACAACTGCTCTGCCTTTATACTCGAGTATAAAGGCAGAGCAGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)