EMAIL THIS PAGE TO A FRIEND

MRPL45

mitochondrial ribosomal protein L45

48 Gene Product Result for
Synonyms: L45mt MRP-L45
UniProtKB ID: Q9BRJ2, A1L436, Q6ZMJ5
Gene ID:
Human(84311) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Alternative splicing results in multiple transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 2p and 17q. [provided by RefSeq, May 2013]
Mouse(67036) mitochondrial ribosomal protein L45
Rat(287656) mitochondrial ribosomal protein L45
Zebrafish(393277) mitochondrial ribosomal protein L45
fruit fly(42671) mitochondrial ribosomal protein L45
cow(511479) mitochondrial ribosomal protein L45
domestic cat(101098344) mitochondrial ribosomal protein L45
dog(488439) mitochondrial ribosomal protein L45
chicken(426233) mitochondrial ribosomal protein L45
naked mole-rat(101725471) mitochondrial ribosomal protein L45
domestic guinea pig(100724085) mitochondrial ribosomal protein L45
sheep(101119405) mitochondrial ribosomal protein L45
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032351 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032351 Rosetta Predictions human pricing
NM_001105834 Rosetta Predictions rat pricing
NM_025927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359740 predicted 457
2 SASI_Hs01_00089760 predicted 873
3 SASI_Hs01_00089762 predicted 662
4 SASI_Hs01_00089763 predicted 694
5 SASI_Hs01_00089764 predicted 873
6 SASI_Hs01_00089765 predicted 634
7 SASI_Hs01_00089766 predicted 1159
8 SASI_Hs01_00089769 predicted 836
9 SASI_Hs02_00359741 predicted 921
10 SASI_Hs01_00089761 predicted 341
11 SASI_Hs01_00089767 predicted 472
12 SASI_Hs01_00089768 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212986 predicted 332
2 SASI_Rn02_00212987 predicted 221
3 SASI_Rn02_00212988 predicted 362
4 SASI_Rn02_00212989 predicted 286
5 SASI_Rn02_00212990 predicted 859
6 SASI_Rn02_00212991 predicted 280
7 SASI_Rn02_00212992 predicted 262
8 SASI_Rn02_00212993 predicted 408
9 SASI_Rn02_00212994 predicted 598
10 SASI_Rn02_00212995 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329295 predicted 788
2 SASI_Mm02_00329296 predicted 830
3 SASI_Mm02_00329297 predicted 443
4 SASI_Mm02_00329298 predicted 234
5 SASI_Mm02_00329299 predicted 766
6 SASI_Mm02_00329300 predicted 353
7 SASI_Mm02_00329301 predicted 255
8 SASI_Mm02_00329302 predicted 245
9 SASI_Mm02_00329303 predicted 327
10 SASI_Mm02_00329304 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032351
VALIDATED
MRPL45 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L45
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-228s21c1
Sequence:CCGGGTGACTCAGTCCGCAGCTATACTCGAGTATAGCTGCGGACTGAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032351.3-1546s21c1
Sequence:CCGGGCGATGTGACTTTAAGGAAATCTCGAGATTTCCTTAAAGTCACATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032351.3-723s1c1
Sequence:CCGGCCCTCTCATGTTGTTCAAGTTCTCGAGAACTTGAACAACATGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032351.3-279s1c1
Sequence:CCGGCCTCCTATTTATCAACCTAAACTCGAGTTTAGGTTGATAAATAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032351.3-840s1c1
Sequence:CCGGCGGTTGATGTATGGACAGGAACTCGAGTTCCTGTCCATACATCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032351.3-637s1c1
Sequence:CCGGCCTTGGTAACTGAACACTGTTCTCGAGAACAGTGTTCAGTTACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032351.3-396s1c1
Sequence:CCGGGCTGGTATATTTGATGCCTATCTCGAGATAGGCATCAAATATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-425s21c1
Sequence:CCGGTGAGGGTGATGCACGCATATCCTCGAGGATATGCGTGCATCACCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-531s21c1
Sequence:CCGGGACTATGATGCCAACTTTAAACTCGAGTTTAAAGTTGGCATCATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-666s21c1
Sequence:CCGGATGACTTGGGACATCAAATATCTCGAGATATTTGATGTCCCAAGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-332s21c1
Sequence:CCGGCCGGAAAGCAGGATTGGTTATCTCGAGATAACCAATCCTGCTTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032351.3-1307s21c1
Sequence:CCGGGTCTAGATGAAAGACAGTATGCTCGAGCATACTGTCTTTCATCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-509s21c1
Sequence:CCGGAGTGTCAATCCGGAGGATAAACTCGAGTTTATCCTCCGGATTGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032351
VALIDATED
MRPL45 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L45
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-228s21c1
Sequence:CCGGGTGACTCAGTCCGCAGCTATACTCGAGTATAGCTGCGGACTGAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032351.3-1546s21c1
Sequence:CCGGGCGATGTGACTTTAAGGAAATCTCGAGATTTCCTTAAAGTCACATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032351.3-723s1c1
Sequence:CCGGCCCTCTCATGTTGTTCAAGTTCTCGAGAACTTGAACAACATGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032351.3-279s1c1
Sequence:CCGGCCTCCTATTTATCAACCTAAACTCGAGTTTAGGTTGATAAATAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032351.3-840s1c1
Sequence:CCGGCGGTTGATGTATGGACAGGAACTCGAGTTCCTGTCCATACATCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032351.3-637s1c1
Sequence:CCGGCCTTGGTAACTGAACACTGTTCTCGAGAACAGTGTTCAGTTACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032351.3-396s1c1
Sequence:CCGGGCTGGTATATTTGATGCCTATCTCGAGATAGGCATCAAATATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-425s21c1
Sequence:CCGGTGAGGGTGATGCACGCATATCCTCGAGGATATGCGTGCATCACCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-531s21c1
Sequence:CCGGGACTATGATGCCAACTTTAAACTCGAGTTTAAAGTTGGCATCATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-666s21c1
Sequence:CCGGATGACTTGGGACATCAAATATCTCGAGATATTTGATGTCCCAAGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-332s21c1
Sequence:CCGGCCGGAAAGCAGGATTGGTTATCTCGAGATAACCAATCCTGCTTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032351.3-1307s21c1
Sequence:CCGGGTCTAGATGAAAGACAGTATGCTCGAGCATACTGTCTTTCATCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-509s21c1
Sequence:CCGGAGTGTCAATCCGGAGGATAAACTCGAGTTTATCCTCCGGATTGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032351
VALIDATED
MRPL45 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L45
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-228s21c1
Sequence:CCGGGTGACTCAGTCCGCAGCTATACTCGAGTATAGCTGCGGACTGAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032351.3-1546s21c1
Sequence:CCGGGCGATGTGACTTTAAGGAAATCTCGAGATTTCCTTAAAGTCACATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032351.3-723s1c1
Sequence:CCGGCCCTCTCATGTTGTTCAAGTTCTCGAGAACTTGAACAACATGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032351.3-279s1c1
Sequence:CCGGCCTCCTATTTATCAACCTAAACTCGAGTTTAGGTTGATAAATAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032351.3-840s1c1
Sequence:CCGGCGGTTGATGTATGGACAGGAACTCGAGTTCCTGTCCATACATCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032351.3-637s1c1
Sequence:CCGGCCTTGGTAACTGAACACTGTTCTCGAGAACAGTGTTCAGTTACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032351.3-396s1c1
Sequence:CCGGGCTGGTATATTTGATGCCTATCTCGAGATAGGCATCAAATATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-425s21c1
Sequence:CCGGTGAGGGTGATGCACGCATATCCTCGAGGATATGCGTGCATCACCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-531s21c1
Sequence:CCGGGACTATGATGCCAACTTTAAACTCGAGTTTAAAGTTGGCATCATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-666s21c1
Sequence:CCGGATGACTTGGGACATCAAATATCTCGAGATATTTGATGTCCCAAGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-332s21c1
Sequence:CCGGCCGGAAAGCAGGATTGGTTATCTCGAGATAACCAATCCTGCTTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032351.3-1307s21c1
Sequence:CCGGGTCTAGATGAAAGACAGTATGCTCGAGCATACTGTCTTTCATCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032351.3-509s21c1
Sequence:CCGGAGTGTCAATCCGGAGGATAAACTCGAGTTTATCCTCCGGATTGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025927
VALIDATED
MRPL45 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L45
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025927.3-2111s21c1
Sequence:CCGGCCATCCCAGAATACTACTTTACTCGAGTAAAGTAGTATTCTGGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-374s21c1
Sequence:CCGGAGCTGGCAATCCGAAAGATAACTCGAGTTATCTTTCGGATTGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-252s21c1
Sequence:CCGGGGCCTGTACAGCTGGTATATTCTCGAGAATATACCAGCTGTACAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-929s21c1
Sequence:CCGGAGCTAGCCTGATGGCGTTAATCTCGAGATTAACGCCATCAGGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-200s21c1
Sequence:CCGGGGAAAGCGGGATTGGTCATTCCTCGAGGAATGACCAATCCCGCTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025927
VALIDATED
MRPL45 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L45
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025927.3-2111s21c1
Sequence:CCGGCCATCCCAGAATACTACTTTACTCGAGTAAAGTAGTATTCTGGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-374s21c1
Sequence:CCGGAGCTGGCAATCCGAAAGATAACTCGAGTTATCTTTCGGATTGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-252s21c1
Sequence:CCGGGGCCTGTACAGCTGGTATATTCTCGAGAATATACCAGCTGTACAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-929s21c1
Sequence:CCGGAGCTAGCCTGATGGCGTTAATCTCGAGATTAACGCCATCAGGCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-200s21c1
Sequence:CCGGGGAAAGCGGGATTGGTCATTCCTCGAGGAATGACCAATCCCGCTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025927
VALIDATED
MRPL45 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L45
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025927.3-2111s21c1
Sequence:CCGGCCATCCCAGAATACTACTTTACTCGAGTAAAGTAGTATTCTGGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-374s21c1
Sequence:CCGGAGCTGGCAATCCGAAAGATAACTCGAGTTATCTTTCGGATTGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-252s21c1
Sequence:CCGGGGCCTGTACAGCTGGTATATTCTCGAGAATATACCAGCTGTACAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-929s21c1
Sequence:CCGGAGCTAGCCTGATGGCGTTAATCTCGAGATTAACGCCATCAGGCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025927.3-200s21c1
Sequence:CCGGGGAAAGCGGGATTGGTCATTCCTCGAGGAATGACCAATCCCGCTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)