EMAIL THIS PAGE TO A FRIEND

MRPL46

mitochondrial ribosomal protein L46

65 Gene Product Result for
Synonyms: C15orf4 LIECG2 P2ECSL
UniProtKB ID: Q9H2W6, B2RD75, Q9HBU8
Gene ID:
Human(26589) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(67308) mitochondrial ribosomal protein L46
Rat(293054) mitochondrial ribosomal protein L46
Zebrafish(436791) mitochondrial ribosomal protein L46
chicken(415499) mitochondrial ribosomal protein L46
domestic cat(101085289) mitochondrial ribosomal protein L46
cow(540720) mitochondrial ribosomal protein L46
dog(479035) mitochondrial ribosomal protein L46
fruit fly(38230) mitochondrial ribosomal protein L46
sheep(101122386) mitochondrial ribosomal protein L46
domestic guinea pig(100731221) mitochondrial ribosomal protein L46
naked mole-rat(101724087) mitochondrial ribosomal protein L46
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022163 Rosetta Predictions human pricing
NM_001013068 Rosetta Predictions rat pricing
NM_023331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355595 predicted 230
2 SASI_Hs01_00089581 predicted 285
3 SASI_Hs01_00089582 predicted 286
4 SASI_Hs01_00089583 predicted 759
5 SASI_Hs01_00089584 predicted 288
6 SASI_Hs01_00089585 predicted 483
7 SASI_Hs01_00089586 predicted 452
8 SASI_Hs01_00089588 predicted 392
9 SASI_Hs01_00089589 predicted 454
10 SASI_Hs01_00089590 predicted 673
11 SASI_Hs01_00089587 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049606 predicted 220
2 SASI_Rn01_00049607 predicted 913
3 SASI_Rn01_00049608 predicted 766
4 SASI_Rn01_00049609 predicted 647
5 SASI_Rn02_00200694 predicted 874
6 SASI_Rn01_00049611 predicted 739
7 SASI_Rn02_00200695 predicted 872
8 SASI_Rn01_00049612 predicted 779
9 SASI_Rn01_00049613 predicted 809
10 SASI_Rn01_00049614 predicted 907
11 SASI_Rn01_00049610 predicted 218
12 SASI_Rn01_00049615 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066724 predicted 800
2 SASI_Mm01_00066725 predicted 233
3 SASI_Mm01_00066727 predicted 795
4 SASI_Mm01_00066728 predicted 246
5 SASI_Mm01_00066729 predicted 235
6 SASI_Mm01_00066730 predicted 801
7 SASI_Mm01_00066731 predicted 798
8 SASI_Mm01_00066732 predicted 678
9 SASI_Mm01_00066733 predicted 233
10 SASI_Mm02_00327067 predicted 773
11 SASI_Mm01_00066726 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023331
VALIDATED
MRPL46 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L46
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023331.2-986s21c1
Sequence:CCGGGCAGACTCAATTCGAGAATTACTCGAGTAATTCTCGAATTGAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023331.2-554s21c1
Sequence:CCGGGACCAAGATGTTTGGATGCTTCTCGAGAAGCATCCAAACATCTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023331.2-362s21c1
Sequence:CCGGGCTGACCTTTATGATGAGGAACTCGAGTTCCTCATCATAAAGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023331.2-506s21c1
Sequence:CCGGCGAAAGCTAGACAGAAACCTTCTCGAGAAGGTTTCTGTCTAGCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023331.2-554s1c1
Sequence:CCGGGACCAAGATGTTTGGATGCTTCTCGAGAAGCATCCAAACATCTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023331.2-506s1c1
Sequence:CCGGCGAAAGCTAGACAGAAACCTTCTCGAGAAGGTTTCTGTCTAGCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023331.2-362s1c1
Sequence:CCGGGCTGACCTTTATGATGAGGAACTCGAGTTCCTCATCATAAAGGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023331.2-986s1c1
Sequence:CCGGGCAGACTCAATTCGAGAATTACTCGAGTAATTCTCGAATTGAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023331.2-365s1c1
Sequence:CCGGGACCTTTATGATGAGGAACAACTCGAGTTGTTCCTCATCATAAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023331
VALIDATED
MRPL46 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L46
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023331.2-986s21c1
Sequence:CCGGGCAGACTCAATTCGAGAATTACTCGAGTAATTCTCGAATTGAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023331.2-554s21c1
Sequence:CCGGGACCAAGATGTTTGGATGCTTCTCGAGAAGCATCCAAACATCTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023331.2-362s21c1
Sequence:CCGGGCTGACCTTTATGATGAGGAACTCGAGTTCCTCATCATAAAGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023331.2-506s21c1
Sequence:CCGGCGAAAGCTAGACAGAAACCTTCTCGAGAAGGTTTCTGTCTAGCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023331.2-554s1c1
Sequence:CCGGGACCAAGATGTTTGGATGCTTCTCGAGAAGCATCCAAACATCTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023331.2-506s1c1
Sequence:CCGGCGAAAGCTAGACAGAAACCTTCTCGAGAAGGTTTCTGTCTAGCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023331.2-362s1c1
Sequence:CCGGGCTGACCTTTATGATGAGGAACTCGAGTTCCTCATCATAAAGGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023331.2-986s1c1
Sequence:CCGGGCAGACTCAATTCGAGAATTACTCGAGTAATTCTCGAATTGAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023331.2-365s1c1
Sequence:CCGGGACCTTTATGATGAGGAACAACTCGAGTTGTTCCTCATCATAAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023331
VALIDATED
MRPL46 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L46
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023331.2-986s21c1
Sequence:CCGGGCAGACTCAATTCGAGAATTACTCGAGTAATTCTCGAATTGAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023331.2-554s21c1
Sequence:CCGGGACCAAGATGTTTGGATGCTTCTCGAGAAGCATCCAAACATCTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023331.2-362s21c1
Sequence:CCGGGCTGACCTTTATGATGAGGAACTCGAGTTCCTCATCATAAAGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023331.2-506s21c1
Sequence:CCGGCGAAAGCTAGACAGAAACCTTCTCGAGAAGGTTTCTGTCTAGCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023331.2-554s1c1
Sequence:CCGGGACCAAGATGTTTGGATGCTTCTCGAGAAGCATCCAAACATCTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023331.2-506s1c1
Sequence:CCGGCGAAAGCTAGACAGAAACCTTCTCGAGAAGGTTTCTGTCTAGCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023331.2-362s1c1
Sequence:CCGGGCTGACCTTTATGATGAGGAACTCGAGTTCCTCATCATAAAGGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023331.2-986s1c1
Sequence:CCGGGCAGACTCAATTCGAGAATTACTCGAGTAATTCTCGAATTGAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023331.2-365s1c1
Sequence:CCGGGACCTTTATGATGAGGAACAACTCGAGTTGTTCCTCATCATAAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022163
VALIDATED
MRPL46 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L46
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-344s21c1
Sequence:CCGGGATGAAGAAGATGAACAGGATCTCGAGATCCTGTTCATCTTCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-723s21c1
Sequence:CCGGTCTTCAAAGCACTGCTATTAACTCGAGTTAATAGCAGTGCTTTGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-499s21c1
Sequence:CCGGCCTGTTAGTCAGAGAGAAGTTCTCGAGAACTTCTCTCTGACTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-796s21c1
Sequence:CCGGGGATGAGCTGGGTGACTATTTCTCGAGAAATAGTCACCCAGCTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-454s21c1
Sequence:CCGGGAATGACCGAACATCCCTGAACTCGAGTTCAGGGATGTTCGGTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-306s1c1
Sequence:CCGGGCAAAGAAGAAAGCTGACCTTCTCGAGAAGGTCAGCTTTCTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-440s1c1
Sequence:CCGGGAATGACCGAACATCCCTGAACTCGAGTTCAGGGATGTTCGGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-330s1c1
Sequence:CCGGGATGAAGAAGATGAACAGGATCTCGAGATCCTGTTCATCTTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022163.2-696s1c1
Sequence:CCGGGCCAAGGTGTTCTTCTTCAAACTCGAGTTTGAAGAAGAACACCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022163.2-612s1c1
Sequence:CCGGGAAGCCAAGTTCCTAGGAAATCTCGAGATTTCCTAGGAACTTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-418s1c1
Sequence:CCGGGCATAACAGAAGCTGATGAAACTCGAGTTTCATCAGCTTCTGTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-485s1c1
Sequence:CCGGCCTGTTAGTCAGAGAGAAGTTCTCGAGAACTTCTCTCTGACTAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022163
VALIDATED
MRPL46 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L46
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-344s21c1
Sequence:CCGGGATGAAGAAGATGAACAGGATCTCGAGATCCTGTTCATCTTCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-723s21c1
Sequence:CCGGTCTTCAAAGCACTGCTATTAACTCGAGTTAATAGCAGTGCTTTGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-499s21c1
Sequence:CCGGCCTGTTAGTCAGAGAGAAGTTCTCGAGAACTTCTCTCTGACTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-796s21c1
Sequence:CCGGGGATGAGCTGGGTGACTATTTCTCGAGAAATAGTCACCCAGCTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-454s21c1
Sequence:CCGGGAATGACCGAACATCCCTGAACTCGAGTTCAGGGATGTTCGGTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-306s1c1
Sequence:CCGGGCAAAGAAGAAAGCTGACCTTCTCGAGAAGGTCAGCTTTCTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-440s1c1
Sequence:CCGGGAATGACCGAACATCCCTGAACTCGAGTTCAGGGATGTTCGGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-330s1c1
Sequence:CCGGGATGAAGAAGATGAACAGGATCTCGAGATCCTGTTCATCTTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022163.2-696s1c1
Sequence:CCGGGCCAAGGTGTTCTTCTTCAAACTCGAGTTTGAAGAAGAACACCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022163.2-612s1c1
Sequence:CCGGGAAGCCAAGTTCCTAGGAAATCTCGAGATTTCCTAGGAACTTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-418s1c1
Sequence:CCGGGCATAACAGAAGCTGATGAAACTCGAGTTTCATCAGCTTCTGTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-485s1c1
Sequence:CCGGCCTGTTAGTCAGAGAGAAGTTCTCGAGAACTTCTCTCTGACTAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022163
VALIDATED
MRPL46 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L46
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-344s21c1
Sequence:CCGGGATGAAGAAGATGAACAGGATCTCGAGATCCTGTTCATCTTCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-723s21c1
Sequence:CCGGTCTTCAAAGCACTGCTATTAACTCGAGTTAATAGCAGTGCTTTGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-499s21c1
Sequence:CCGGCCTGTTAGTCAGAGAGAAGTTCTCGAGAACTTCTCTCTGACTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-796s21c1
Sequence:CCGGGGATGAGCTGGGTGACTATTTCTCGAGAAATAGTCACCCAGCTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022163.3-454s21c1
Sequence:CCGGGAATGACCGAACATCCCTGAACTCGAGTTCAGGGATGTTCGGTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-306s1c1
Sequence:CCGGGCAAAGAAGAAAGCTGACCTTCTCGAGAAGGTCAGCTTTCTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-440s1c1
Sequence:CCGGGAATGACCGAACATCCCTGAACTCGAGTTCAGGGATGTTCGGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-330s1c1
Sequence:CCGGGATGAAGAAGATGAACAGGATCTCGAGATCCTGTTCATCTTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022163.2-696s1c1
Sequence:CCGGGCCAAGGTGTTCTTCTTCAAACTCGAGTTTGAAGAAGAACACCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022163.2-612s1c1
Sequence:CCGGGAAGCCAAGTTCCTAGGAAATCTCGAGATTTCCTAGGAACTTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-418s1c1
Sequence:CCGGGCATAACAGAAGCTGATGAAACTCGAGTTTCATCAGCTTCTGTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022163.2-485s1c1
Sequence:CCGGCCTGTTAGTCAGAGAGAAGTTCTCGAGAACTTCTCTCTGACTAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)