EMAIL THIS PAGE TO A FRIEND

MRPL47

mitochondrial ribosomal protein L47

64 Gene Product Result for
Synonyms: L47mt MRP-L47 NCM1
UniProtKB ID: Q9HD33, Q6XRG1, Q8N5D1
Gene ID:
Human(57129) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. This gene is immediately adjacent to the gene for BAF complex 53 kDa subunit protein a (BAF53a), in a tail-to-tail orientation. Two transcript variants encoding different protein isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(74600) mitochondrial ribosomal protein L47
Rat(294963) mitochondrial ribosomal protein L47
naked mole-rat(101715829) mitochondrial ribosomal protein L47
domestic guinea pig(100725376) mitochondrial ribosomal protein L47
sheep(101108442) mitochondrial ribosomal protein L47
Zebrafish(338277) mitochondrial ribosomal protein L47
cow(534317) mitochondrial ribosomal protein L47
domestic cat(101090596) mitochondrial ribosomal protein L47
dog(478638) mitochondrial ribosomal protein L47
chicken(424977) mitochondrial ribosomal protein L47
fruit fly(41141) mitochondrial ribosomal protein L47
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020409 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020409 Rosetta Predictions human pricing
NM_177988 Rosetta Predictions human pricing
NM_001037183 Rosetta Predictions rat pricing
NM_029017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244814 predicted 921
2 SASI_Hs01_00244815 predicted 919
3 SASI_Hs01_00244816 predicted 930
4 SASI_Hs01_00244817 predicted 465
5 SASI_Hs01_00244818 predicted 660
6 SASI_Hs01_00244819 predicted 770
7 SASI_Hs01_00244820 predicted 657
8 SASI_Hs01_00244821 predicted 752
9 SASI_Hs01_00244823 predicted 930
10 SASI_Hs02_00353411 predicted 674
11 SASI_Hs01_00244822 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228204 predicted 773
2 SASI_Hs01_00228205 predicted 779
3 SASI_Hs01_00228206 predicted 784
4 SASI_Hs01_00228207 predicted 515
5 SASI_Hs01_00228208 predicted 631
6 SASI_Hs01_00228209 predicted 504
7 SASI_Hs01_00228210 predicted 608
8 SASI_Hs01_00228212 predicted 786
9 SASI_Hs02_00369460 predicted 523
10 SASI_Hs01_00228213 predicted 731
11 SASI_Hs01_00228211 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118106 predicted 583
2 SASI_Rn01_00118107 predicted 329
3 SASI_Rn01_00118108 predicted 736
4 SASI_Rn01_00118109 predicted 557
5 SASI_Rn01_00118110 predicted 295
6 SASI_Rn01_00118111 predicted 642
7 SASI_Rn01_00118112 predicted 280
8 SASI_Rn01_00118113 predicted 416
9 SASI_Rn01_00118114 predicted 729
10 SASI_Rn02_00204253 predicted 816
11 SASI_Rn01_00118115 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166986 predicted 553
2 SASI_Mm01_00166987 predicted 559
3 SASI_Mm01_00166988 predicted 544
4 SASI_Mm01_00166989 predicted 617
5 SASI_Mm02_00334755 predicted 325
6 SASI_Mm02_00334756 predicted 595
7 SASI_Mm01_00166990 predicted 449
8 SASI_Mm02_00334757 predicted 484
9 SASI_Mm02_00334758 predicted 315
10 SASI_Mm01_00166992 predicted 361
11 SASI_Mm01_00166991 predicted 452
12 SASI_Mm01_00166993 predicted 507
13 SASI_Mm01_00166994 predicted 570
14 SASI_Mm01_00166995 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020409
VALIDATED
MRPL47 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L47
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020409.2-1053s1c1
Sequence:CCGGGATGGTAACTGCCACAGCAAACTCGAGTTTGCTGTGGCAGTTACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020409.2-625s1c1
Sequence:CCGGCTTGCCTTATGTGGACCATTTCTCGAGAAATGGTCCACATAAGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_020409.2-428s1c1
Sequence:CCGGGTAGATTCCATGGATGCATTACTCGAGTAATGCATCCATGGAATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020409.2-975s1c1
Sequence:CCGGCAGATGAGATTCCCACTTTATCTCGAGATAAAGTGGGAATCTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020409.2-1002s21c1
Sequence:CCGGTGACATTTAAGCAGGCTTTAACTCGAGTTAAAGCCTGCTTAAATGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_020409.2-675s1c1
Sequence:CCGGGCATCAAAGCACGGAAGGAAACTCGAGTTTCCTTCCGTGCTTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_020409.2-575s1c1
Sequence:CCGGGTTATACCTTGGCACCTAAATCTCGAGATTTAGGTGCCAAGGTATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020409.2-73s21c1
Sequence:CCGGGAAATCTTCCCGATCGTTAATCTCGAGATTAACGATCGGGAAGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020409.2-871s21c1
Sequence:CCGGTAGTCAAGTGACTTTACTAATCTCGAGATTAGTAAAGTCACTTGACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020409.2-545s21c1
Sequence:CCGGAGAATCATCTGGCACAAGTTCCTCGAGGAACTTGTGCCAGATGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020409.2-404s21c1
Sequence:CCGGAGTCCAGAGCGGTTAGATAAGCTCGAGCTTATCTAACCGCTCTGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020409
VALIDATED
MRPL47 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L47
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020409.2-1053s1c1
Sequence:CCGGGATGGTAACTGCCACAGCAAACTCGAGTTTGCTGTGGCAGTTACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020409.2-625s1c1
Sequence:CCGGCTTGCCTTATGTGGACCATTTCTCGAGAAATGGTCCACATAAGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_020409.2-428s1c1
Sequence:CCGGGTAGATTCCATGGATGCATTACTCGAGTAATGCATCCATGGAATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020409.2-975s1c1
Sequence:CCGGCAGATGAGATTCCCACTTTATCTCGAGATAAAGTGGGAATCTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020409.2-1002s21c1
Sequence:CCGGTGACATTTAAGCAGGCTTTAACTCGAGTTAAAGCCTGCTTAAATGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_020409.2-675s1c1
Sequence:CCGGGCATCAAAGCACGGAAGGAAACTCGAGTTTCCTTCCGTGCTTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_020409.2-575s1c1
Sequence:CCGGGTTATACCTTGGCACCTAAATCTCGAGATTTAGGTGCCAAGGTATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020409.2-73s21c1
Sequence:CCGGGAAATCTTCCCGATCGTTAATCTCGAGATTAACGATCGGGAAGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020409.2-871s21c1
Sequence:CCGGTAGTCAAGTGACTTTACTAATCTCGAGATTAGTAAAGTCACTTGACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020409.2-545s21c1
Sequence:CCGGAGAATCATCTGGCACAAGTTCCTCGAGGAACTTGTGCCAGATGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020409.2-404s21c1
Sequence:CCGGAGTCCAGAGCGGTTAGATAAGCTCGAGCTTATCTAACCGCTCTGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020409
VALIDATED
MRPL47 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L47
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020409.2-1053s1c1
Sequence:CCGGGATGGTAACTGCCACAGCAAACTCGAGTTTGCTGTGGCAGTTACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020409.2-625s1c1
Sequence:CCGGCTTGCCTTATGTGGACCATTTCTCGAGAAATGGTCCACATAAGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_020409.2-428s1c1
Sequence:CCGGGTAGATTCCATGGATGCATTACTCGAGTAATGCATCCATGGAATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020409.2-975s1c1
Sequence:CCGGCAGATGAGATTCCCACTTTATCTCGAGATAAAGTGGGAATCTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020409.2-1002s21c1
Sequence:CCGGTGACATTTAAGCAGGCTTTAACTCGAGTTAAAGCCTGCTTAAATGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_020409.2-675s1c1
Sequence:CCGGGCATCAAAGCACGGAAGGAAACTCGAGTTTCCTTCCGTGCTTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_020409.2-575s1c1
Sequence:CCGGGTTATACCTTGGCACCTAAATCTCGAGATTTAGGTGCCAAGGTATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020409.2-73s21c1
Sequence:CCGGGAAATCTTCCCGATCGTTAATCTCGAGATTAACGATCGGGAAGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020409.2-871s21c1
Sequence:CCGGTAGTCAAGTGACTTTACTAATCTCGAGATTAGTAAAGTCACTTGACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020409.2-545s21c1
Sequence:CCGGAGAATCATCTGGCACAAGTTCCTCGAGGAACTTGTGCCAGATGATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020409.2-404s21c1
Sequence:CCGGAGTCCAGAGCGGTTAGATAAGCTCGAGCTTATCTAACCGCTCTGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029017
VALIDATED
MRPL47 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L47
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-91s21c1
Sequence:CCGGGCAGCTTGTTCCCTAGTAAATCTCGAGATTTACTAGGGAACAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-91s1c1
Sequence:CCGGGCAGCTTGTTCCCTAGTAAATCTCGAGATTTACTAGGGAACAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-134s21c1
Sequence:CCGGGTTGCAGGTCTTCTCTTAGTTCTCGAGAACTAAGAGAAGACCTGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-594s21c1
Sequence:CCGGGCCTATACCTTGGTACCTAAACTCGAGTTTAGGTACCAAGGTATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-331s1c1
Sequence:CCGGGACTTACATAAGCTTTGGTATCTCGAGATACCAAAGCTTATGTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-594s1c1
Sequence:CCGGGCCTATACCTTGGTACCTAAACTCGAGTTTAGGTACCAAGGTATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-134s1c1
Sequence:CCGGGTTGCAGGTCTTCTCTTAGTTCTCGAGAACTAAGAGAAGACCTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-490s1c1
Sequence:CCGGGAAGATGCTCTAAGGCTTCTTCTCGAGAAGAAGCCTTAGAGCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-331s21c1
Sequence:CCGGGACTTACATAAGCTTTGGTATCTCGAGATACCAAAGCTTATGTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029017
VALIDATED
MRPL47 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L47
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-91s21c1
Sequence:CCGGGCAGCTTGTTCCCTAGTAAATCTCGAGATTTACTAGGGAACAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-91s1c1
Sequence:CCGGGCAGCTTGTTCCCTAGTAAATCTCGAGATTTACTAGGGAACAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-134s21c1
Sequence:CCGGGTTGCAGGTCTTCTCTTAGTTCTCGAGAACTAAGAGAAGACCTGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-594s21c1
Sequence:CCGGGCCTATACCTTGGTACCTAAACTCGAGTTTAGGTACCAAGGTATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-331s1c1
Sequence:CCGGGACTTACATAAGCTTTGGTATCTCGAGATACCAAAGCTTATGTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-594s1c1
Sequence:CCGGGCCTATACCTTGGTACCTAAACTCGAGTTTAGGTACCAAGGTATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-134s1c1
Sequence:CCGGGTTGCAGGTCTTCTCTTAGTTCTCGAGAACTAAGAGAAGACCTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-490s1c1
Sequence:CCGGGAAGATGCTCTAAGGCTTCTTCTCGAGAAGAAGCCTTAGAGCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-331s21c1
Sequence:CCGGGACTTACATAAGCTTTGGTATCTCGAGATACCAAAGCTTATGTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029017
VALIDATED
MRPL47 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L47
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-91s21c1
Sequence:CCGGGCAGCTTGTTCCCTAGTAAATCTCGAGATTTACTAGGGAACAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-91s1c1
Sequence:CCGGGCAGCTTGTTCCCTAGTAAATCTCGAGATTTACTAGGGAACAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-134s21c1
Sequence:CCGGGTTGCAGGTCTTCTCTTAGTTCTCGAGAACTAAGAGAAGACCTGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-594s21c1
Sequence:CCGGGCCTATACCTTGGTACCTAAACTCGAGTTTAGGTACCAAGGTATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-331s1c1
Sequence:CCGGGACTTACATAAGCTTTGGTATCTCGAGATACCAAAGCTTATGTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-594s1c1
Sequence:CCGGGCCTATACCTTGGTACCTAAACTCGAGTTTAGGTACCAAGGTATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-134s1c1
Sequence:CCGGGTTGCAGGTCTTCTCTTAGTTCTCGAGAACTAAGAGAAGACCTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029017.1-490s1c1
Sequence:CCGGGAAGATGCTCTAAGGCTTCTTCTCGAGAAGAAGCCTTAGAGCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029017.1-331s21c1
Sequence:CCGGGACTTACATAAGCTTTGGTATCTCGAGATACCAAAGCTTATGTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)