EMAIL THIS PAGE TO A FRIEND

MRPL48

mitochondrial ribosomal protein L48

122 Gene Product Result for
Synonyms: HSPC290 L48MT MRP-L48
UniProtKB ID: Q96GC5, Q49AK7, Q4U2Q4, Q9P091, Q9Y5J0
Gene ID:
Human(51642) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 6p. [provided by RefSeq, Jul 2008]
Mouse(52443) mitochondrial ribosomal protein L48
Rat(293149) mitochondrial ribosomal protein L48
Zebrafish(503593) mitochondrial ribosomal protein L48
chicken(419062) mitochondrial ribosomal protein L48
dog(476812) mitochondrial ribosomal protein L48
cow(615873) mitochondrial ribosomal protein L48
domestic cat(101081666) mitochondrial ribosomal protein L48
fruit fly(33348) mitochondrial ribosomal protein L48
sheep(101103920) mitochondrial ribosomal protein L48
domestic guinea pig(100735427) mitochondrial ribosomal protein L48
naked mole-rat(101720159) mitochondrial ribosomal protein L48
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030046 Rosetta Predictions human pricing
NM_016055 Rosetta Predictions human pricing
NM_001106282 Rosetta Predictions rat pricing
NM_026971 Rosetta Predictions mouse pricing
NM_198831 Rosetta Predictions mouse pricing
NR_003559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048220 predicted 1147
2 SASI_Hs01_00048221 predicted 1099
3 SASI_Hs01_00048222 predicted 1118
4 SASI_Hs01_00048223 predicted 1241
5 SASI_Hs01_00048224 predicted 1145
6 SASI_Hs01_00048225 predicted 1175
7 SASI_Hs01_00048226 predicted 1122
8 SASI_Hs01_00048227 predicted 962
9 SASI_Hs01_00048228 predicted 1098
10 SASI_Hs01_00048229 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182583 predicted 466
2 SASI_Hs01_00182587 predicted 437
3 SASI_Hs02_00348780 predicted 407
4 SASI_Hs01_00182588 predicted 550
5 SASI_Hs02_00348781 predicted 212
6 SASI_Hs02_00348782 predicted 616
7 SASI_Hs02_00348783 predicted 320
8 SASI_Hs01_00182589 predicted 458
9 SASI_Hs02_00348784 predicted 465
10 SASI_Hs02_00348785 predicted 408
11 SASI_Hs01_00182584 predicted 1274
12 SASI_Hs01_00182585 predicted 979
13 SASI_Hs01_00182586 predicted 1235
14 SASI_Hs01_00182590 predicted 1277
15 SASI_Hs01_00182591 predicted 1045
16 SASI_Hs01_00182592 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217438 predicted 579
2 SASI_Rn02_00217439 predicted 561
3 SASI_Rn02_00217440 predicted 583
4 SASI_Rn02_00217441 predicted 362
5 SASI_Rn02_00217442 predicted 637
6 SASI_Rn02_00217443 predicted 225
7 SASI_Rn02_00217444 predicted 350
8 SASI_Rn02_00217445 predicted 244
9 SASI_Rn02_00217446 predicted 614
10 SASI_Rn02_00217447 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104991 predicted 378
2 SASI_Mm01_00104992 predicted 593
3 SASI_Mm01_00104993 predicted 475
4 SASI_Mm01_00104994 predicted 690
5 SASI_Mm01_00104995 predicted 666
6 SASI_Mm01_00104996 predicted 530
7 SASI_Mm01_00104997 predicted 473
8 SASI_Mm01_00104998 predicted 383
9 SASI_Mm01_00104999 predicted 623
10 SASI_Mm01_00105000 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351169 predicted 292
2 SASI_Mm02_00351170 predicted 390
3 SASI_Mm01_00073496 predicted 602
4 SASI_Mm02_00351171 predicted 332
5 SASI_Mm02_00351172 predicted 627
6 SASI_Mm01_00073498 predicted 679
7 SASI_Mm02_00351173 predicted 302
8 SASI_Mm01_00073499 predicted 543
9 SASI_Mm02_00351174 predicted 399
10 SASI_Mm02_00351175 predicted 270
11 SASI_Mm01_00073497 predicted 451
12 SASI_Mm01_00073500 predicted 456
13 SASI_Mm01_00073501 predicted 453
14 SASI_Mm01_00073502 predicted 536
15 SASI_Mm01_00073503 predicted 419
16 SASI_Mm01_00073504 predicted 451
17 SASI_Mm01_00073505 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353503 predicted 257
2 SASI_Mm02_00353504 predicted 359
3 SASI_Mm02_00353505 predicted 565
4 SASI_Mm02_00353506 predicted 303
5 SASI_Mm02_00353507 predicted 588
6 SASI_Mm02_00353508 predicted 644
7 SASI_Mm02_00353509 predicted 267
8 SASI_Mm02_00353510 predicted 514
9 SASI_Mm02_00353511 predicted 368
10 SASI_Mm02_00353512 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198831
MRPL48 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L48
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000350193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-644s21c1
Sequence:CCGGGCAATCTTCCAGAAGGAGTCACTCGAGTGACTCCTTCTGGAAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-256s21c1
Sequence:CCGGCACTACAAGACAAAGCCCACTCTCGAGAGTGGGCTTTGTCTTGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-282s21c1
Sequence:CCGGCATCGGAAGATACAGACACTTCTCGAGAAGTGTCTGTATCTTCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-424s21c1
Sequence:CCGGGCAGAAAGTTATGCCCAGTATCTCGAGATACTGGGCATAACTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198831
MRPL48 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L48
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000350193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-644s21c1
Sequence:CCGGGCAATCTTCCAGAAGGAGTCACTCGAGTGACTCCTTCTGGAAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-256s21c1
Sequence:CCGGCACTACAAGACAAAGCCCACTCTCGAGAGTGGGCTTTGTCTTGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-282s21c1
Sequence:CCGGCATCGGAAGATACAGACACTTCTCGAGAAGTGTCTGTATCTTCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-424s21c1
Sequence:CCGGGCAGAAAGTTATGCCCAGTATCTCGAGATACTGGGCATAACTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198831
MRPL48 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L48
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000350193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-644s21c1
Sequence:CCGGGCAATCTTCCAGAAGGAGTCACTCGAGTGACTCCTTCTGGAAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-256s21c1
Sequence:CCGGCACTACAAGACAAAGCCCACTCTCGAGAGTGGGCTTTGTCTTGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-282s21c1
Sequence:CCGGCATCGGAAGATACAGACACTTCTCGAGAAGTGTCTGTATCTTCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198831.2-424s21c1
Sequence:CCGGGCAGAAAGTTATGCCCAGTATCTCGAGATACTGGGCATAACTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016055
VALIDATED
MRPL48 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L48
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-323s21c1
Sequence:CCGGGTGGAAGTGAGAGCCATTAATCTCGAGATTAATGGCTCTCACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016055.5-129s21c1
Sequence:CCGGGCCTGAGGAACAATACCATTTCTCGAGAAATGGTATTGTTCCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-441s21c1
Sequence:CCGGGCAACTCTCTCTCCATTAAAGCTCGAGCTTTAATGGAGAGAGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-756s21c1
Sequence:CCGGCATGCCAGCAGTGGTCATATTCTCGAGAATATGACCACTGCTGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-678s21c1
Sequence:CCGGACTTCAAGGGACGATTCAAAGCTCGAGCTTTGAATCGTCCCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016055.3-597s1c1
Sequence:CCGGGCAGAGAGTTATGCCCAGTATCTCGAGATACTGGGCATAACTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179227    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016055.3-979s1c1
Sequence:CCGGGAAGAGCTTACTGGGTAGTTACTCGAGTAACTACCCAGTAAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016055.3-449s1c1
Sequence:CCGGCCACGGCATTGGAAAGTACAACTCGAGTTGTACTTTCCAATGCCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016055
VALIDATED
MRPL48 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L48
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-323s21c1
Sequence:CCGGGTGGAAGTGAGAGCCATTAATCTCGAGATTAATGGCTCTCACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016055.5-129s21c1
Sequence:CCGGGCCTGAGGAACAATACCATTTCTCGAGAAATGGTATTGTTCCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-441s21c1
Sequence:CCGGGCAACTCTCTCTCCATTAAAGCTCGAGCTTTAATGGAGAGAGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-756s21c1
Sequence:CCGGCATGCCAGCAGTGGTCATATTCTCGAGAATATGACCACTGCTGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-678s21c1
Sequence:CCGGACTTCAAGGGACGATTCAAAGCTCGAGCTTTGAATCGTCCCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016055.3-597s1c1
Sequence:CCGGGCAGAGAGTTATGCCCAGTATCTCGAGATACTGGGCATAACTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179227    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016055.3-979s1c1
Sequence:CCGGGAAGAGCTTACTGGGTAGTTACTCGAGTAACTACCCAGTAAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016055.3-449s1c1
Sequence:CCGGCCACGGCATTGGAAAGTACAACTCGAGTTGTACTTTCCAATGCCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016055
VALIDATED
MRPL48 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L48
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-323s21c1
Sequence:CCGGGTGGAAGTGAGAGCCATTAATCTCGAGATTAATGGCTCTCACTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016055.5-129s21c1
Sequence:CCGGGCCTGAGGAACAATACCATTTCTCGAGAAATGGTATTGTTCCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-441s21c1
Sequence:CCGGGCAACTCTCTCTCCATTAAAGCTCGAGCTTTAATGGAGAGAGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-756s21c1
Sequence:CCGGCATGCCAGCAGTGGTCATATTCTCGAGAATATGACCACTGCTGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016055.5-678s21c1
Sequence:CCGGACTTCAAGGGACGATTCAAAGCTCGAGCTTTGAATCGTCCCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016055.3-597s1c1
Sequence:CCGGGCAGAGAGTTATGCCCAGTATCTCGAGATACTGGGCATAACTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179227    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016055.3-979s1c1
Sequence:CCGGGAAGAGCTTACTGGGTAGTTACTCGAGTAACTACCCAGTAAGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016055.3-449s1c1
Sequence:CCGGCCACGGCATTGGAAAGTACAACTCGAGTTGTACTTTCCAATGCCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026971
MRPL48 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L48
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-239s1c1
Sequence:CCGGCACTACAAGACAAAGCCCACTCTCGAGAGTGGGCTTTGTCTTGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-627s1c1
Sequence:CCGGGCAATCTTCCAGAAGGAGTCACTCGAGTGACTCCTTCTGGAAGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-407s1c1
Sequence:CCGGGCAGAAAGTTATGCCCAGTATCTCGAGATACTGGGCATAACTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-265s1c1
Sequence:CCGGCATCGGAAGATACAGACACTTCTCGAGAAGTGTCTGTATCTTCCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026971
MRPL48 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L48
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-239s1c1
Sequence:CCGGCACTACAAGACAAAGCCCACTCTCGAGAGTGGGCTTTGTCTTGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-627s1c1
Sequence:CCGGGCAATCTTCCAGAAGGAGTCACTCGAGTGACTCCTTCTGGAAGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-407s1c1
Sequence:CCGGGCAGAAAGTTATGCCCAGTATCTCGAGATACTGGGCATAACTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-265s1c1
Sequence:CCGGCATCGGAAGATACAGACACTTCTCGAGAAGTGTCTGTATCTTCCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026971
MRPL48 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L48
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-239s1c1
Sequence:CCGGCACTACAAGACAAAGCCCACTCTCGAGAGTGGGCTTTGTCTTGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-627s1c1
Sequence:CCGGGCAATCTTCCAGAAGGAGTCACTCGAGTGACTCCTTCTGGAAGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-407s1c1
Sequence:CCGGGCAGAAAGTTATGCCCAGTATCTCGAGATACTGGGCATAACTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026971.2-265s1c1
Sequence:CCGGCATCGGAAGATACAGACACTTCTCGAGAAGTGTCTGTATCTTCCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)