EMAIL THIS PAGE TO A FRIEND

MRPL49

mitochondrial ribosomal protein L49

61 Gene Product Result for
Synonyms: C11orf4 L49mt MRP-L49 NOF NOF1
UniProtKB ID: Q13405, B2R4G6
Gene ID:
Human(740) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. Pseudogenes corresponding to this gene are found on chromosomes 5q and 8p. [provided by RefSeq, May 2011]
Mouse(18120) mitochondrial ribosomal protein L49
Rat(309176) mitochondrial ribosomal protein L49
fruit fly(32242) mitochondrial ribosomal protein L49
chicken(100858532) mitochondrial ribosomal protein L49
cow(508359) mitochondrial ribosomal protein L49
domestic cat(101084058) mitochondrial ribosomal protein L49
dog(483747) mitochondrial ribosomal protein L49
sheep(101106725) mitochondrial ribosomal protein L49
naked mole-rat(101697624) mitochondrial ribosomal protein L49
domestic guinea pig(100726278) mitochondrial ribosomal protein L49
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004927 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU027601 MISSION® esiRNA esiRNA targeting mouse Mrpl49 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004927 Rosetta Predictions human pricing
NM_001047883 Rosetta Predictions rat pricing
NM_026246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206832 predicted 403
2 SASI_Hs01_00206838 predicted 386
3 SASI_Hs01_00206833 predicted 493
4 SASI_Hs01_00206839 predicted 605
5 SASI_Hs01_00206834 predicted 327
6 SASI_Hs01_00206835 predicted 564
7 SASI_Hs01_00206836 predicted 554
8 SASI_Hs01_00206837 predicted 96
9 SASI_Hs02_00338593 predicted 450
10 SASI_Hs01_00206840 predicted 684
11 SASI_Hs01_00206841 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206467 predicted 312
2 SASI_Rn02_00206468 predicted 315
3 SASI_Rn02_00206469 predicted 302
4 SASI_Rn02_00206470 predicted 310
5 SASI_Rn02_00206471 predicted 317
6 SASI_Rn02_00206472 predicted 277
7 SASI_Rn02_00206473 predicted 286
8 SASI_Rn02_00206474 predicted 320
9 SASI_Rn02_00206475 predicted 307
10 SASI_Rn02_00206476 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070653 predicted 738
2 SASI_Mm02_00329930 predicted 682
3 SASI_Mm01_00070654 predicted 1015
4 SASI_Mm01_00070655 predicted 358
5 SASI_Mm01_00070656 predicted 416
6 SASI_Mm01_00070657 predicted 602
7 SASI_Mm01_00070658 predicted 977
8 SASI_Mm01_00070659 predicted 464
9 SASI_Mm01_00070660 predicted 617
10 SASI_Mm01_00070662 predicted 849
11 SASI_Mm01_00070661 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026246
VALIDATED
MRPL49 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L49
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-1012s1c1
Sequence:CCGGGCACATACAAATGCGCCTGTACTCGAGTACAGGCGCATTTGTATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026246.1-455s1c1
Sequence:CCGGCTTCGAATCAAGGGCTACTTTCTCGAGAAAGTAGCCCTTGATTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-649s1c1
Sequence:CCGGCCTTGCTTTCATAAAGTACAACTCGAGTTGTACTTTATGAAAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026246.1-747s1c1
Sequence:CCGGGCAGATATTAACTGCTGTATACTCGAGTATACAGCAGTTAATATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-468s1c1
Sequence:CCGGGCTACTTTGATGAGCAACTTACTCGAGTAAGTTGCTCATCAAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-134s1c1
Sequence:CCGGGAGTCTGTGGATGAATACCAACTCGAGTTGGTATTCATCCACAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026246.1-479s1c1
Sequence:CCGGGAGCAACTTAAAGCCTGGCTTCTCGAGAAGCCAGGCTTTAAGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-467s21c1
Sequence:CCGGGCTACTTTGATGAGCAACTTACTCGAGTAAGTTGCTCATCAAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-251s21c1
Sequence:CCGGTTCCCAGCTTGCCCTACTTTGCTCGAGCAAAGTAGGGCAAGCTGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-133s21c1
Sequence:CCGGGAGTCTGTGGATGAATACCAACTCGAGTTGGTATTCATCCACAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-277s21c1
Sequence:CCGGCGCTCTCGGATGCACAATATTCTCGAGAATATTGTGCATCCGAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026246.3-333s1c1
Sequence:CCGGGATGACCTTGATTCGGAAAGTCTCGAGACTTTCCGAATCAAGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026246.3-934s21c1
Sequence:CCGGCAGGCGTAGTCTCGTTTAAATCTCGAGATTTAAACGAGACTACGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026246
VALIDATED
MRPL49 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L49
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-1012s1c1
Sequence:CCGGGCACATACAAATGCGCCTGTACTCGAGTACAGGCGCATTTGTATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026246.1-455s1c1
Sequence:CCGGCTTCGAATCAAGGGCTACTTTCTCGAGAAAGTAGCCCTTGATTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-649s1c1
Sequence:CCGGCCTTGCTTTCATAAAGTACAACTCGAGTTGTACTTTATGAAAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026246.1-747s1c1
Sequence:CCGGGCAGATATTAACTGCTGTATACTCGAGTATACAGCAGTTAATATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-468s1c1
Sequence:CCGGGCTACTTTGATGAGCAACTTACTCGAGTAAGTTGCTCATCAAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-134s1c1
Sequence:CCGGGAGTCTGTGGATGAATACCAACTCGAGTTGGTATTCATCCACAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026246.1-479s1c1
Sequence:CCGGGAGCAACTTAAAGCCTGGCTTCTCGAGAAGCCAGGCTTTAAGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-467s21c1
Sequence:CCGGGCTACTTTGATGAGCAACTTACTCGAGTAAGTTGCTCATCAAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-251s21c1
Sequence:CCGGTTCCCAGCTTGCCCTACTTTGCTCGAGCAAAGTAGGGCAAGCTGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-133s21c1
Sequence:CCGGGAGTCTGTGGATGAATACCAACTCGAGTTGGTATTCATCCACAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-277s21c1
Sequence:CCGGCGCTCTCGGATGCACAATATTCTCGAGAATATTGTGCATCCGAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026246.3-333s1c1
Sequence:CCGGGATGACCTTGATTCGGAAAGTCTCGAGACTTTCCGAATCAAGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026246.3-934s21c1
Sequence:CCGGCAGGCGTAGTCTCGTTTAAATCTCGAGATTTAAACGAGACTACGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026246
VALIDATED
MRPL49 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L49
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-1012s1c1
Sequence:CCGGGCACATACAAATGCGCCTGTACTCGAGTACAGGCGCATTTGTATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026246.1-455s1c1
Sequence:CCGGCTTCGAATCAAGGGCTACTTTCTCGAGAAAGTAGCCCTTGATTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-649s1c1
Sequence:CCGGCCTTGCTTTCATAAAGTACAACTCGAGTTGTACTTTATGAAAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026246.1-747s1c1
Sequence:CCGGGCAGATATTAACTGCTGTATACTCGAGTATACAGCAGTTAATATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-468s1c1
Sequence:CCGGGCTACTTTGATGAGCAACTTACTCGAGTAAGTTGCTCATCAAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026246.1-134s1c1
Sequence:CCGGGAGTCTGTGGATGAATACCAACTCGAGTTGGTATTCATCCACAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026246.1-479s1c1
Sequence:CCGGGAGCAACTTAAAGCCTGGCTTCTCGAGAAGCCAGGCTTTAAGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-467s21c1
Sequence:CCGGGCTACTTTGATGAGCAACTTACTCGAGTAAGTTGCTCATCAAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-251s21c1
Sequence:CCGGTTCCCAGCTTGCCCTACTTTGCTCGAGCAAAGTAGGGCAAGCTGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-133s21c1
Sequence:CCGGGAGTCTGTGGATGAATACCAACTCGAGTTGGTATTCATCCACAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026246.3-277s21c1
Sequence:CCGGCGCTCTCGGATGCACAATATTCTCGAGAATATTGTGCATCCGAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026246.3-333s1c1
Sequence:CCGGGATGACCTTGATTCGGAAAGTCTCGAGACTTTCCGAATCAAGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026246.3-934s21c1
Sequence:CCGGCAGGCGTAGTCTCGTTTAAATCTCGAGATTTAAACGAGACTACGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004927
VALIDATED
MRPL49 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L49
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004927.2-1910s1c1
Sequence:CCGGCCTGGAGATTCCATTCCATTTCTCGAGAAATGGAATGGAATCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004927.2-974s1c1
Sequence:CCGGCCTCTTGAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTCAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004927.2-449s1c1
Sequence:CCGGCTGCAGAAAGACGTGGAAGATCTCGAGATCTTCCACGTCTTTCTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004927.2-272s1c1
Sequence:CCGGCCAAAGCATGAACATTATCCTCTCGAGAGGATAATGTTCATGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-327s21c1
Sequence:CCGGCACCCAACCTGCCTTACTTTGCTCGAGCAAAGTAAGGCAGGTTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-205s21c1
Sequence:CCGGTGTGGAGTCTGTGGATGAATACTCGAGTATTCATCCACAGACTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-974s21c1
Sequence:CCGGCCTCTTGAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004927.2-449s21c1
Sequence:CCGGCTGCAGAAAGACGTGGAAGATCTCGAGATCTTCCACGTCTTTCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-1910s21c1
Sequence:CCGGCCTGGAGATTCCATTCCATTTCTCGAGAAATGGAATGGAATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004927
VALIDATED
MRPL49 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L49
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004927.2-1910s1c1
Sequence:CCGGCCTGGAGATTCCATTCCATTTCTCGAGAAATGGAATGGAATCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004927.2-974s1c1
Sequence:CCGGCCTCTTGAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTCAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004927.2-449s1c1
Sequence:CCGGCTGCAGAAAGACGTGGAAGATCTCGAGATCTTCCACGTCTTTCTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004927.2-272s1c1
Sequence:CCGGCCAAAGCATGAACATTATCCTCTCGAGAGGATAATGTTCATGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-327s21c1
Sequence:CCGGCACCCAACCTGCCTTACTTTGCTCGAGCAAAGTAAGGCAGGTTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-205s21c1
Sequence:CCGGTGTGGAGTCTGTGGATGAATACTCGAGTATTCATCCACAGACTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-974s21c1
Sequence:CCGGCCTCTTGAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004927.2-449s21c1
Sequence:CCGGCTGCAGAAAGACGTGGAAGATCTCGAGATCTTCCACGTCTTTCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-1910s21c1
Sequence:CCGGCCTGGAGATTCCATTCCATTTCTCGAGAAATGGAATGGAATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004927
VALIDATED
MRPL49 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L49
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004927.2-1910s1c1
Sequence:CCGGCCTGGAGATTCCATTCCATTTCTCGAGAAATGGAATGGAATCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004927.2-974s1c1
Sequence:CCGGCCTCTTGAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTCAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004927.2-449s1c1
Sequence:CCGGCTGCAGAAAGACGTGGAAGATCTCGAGATCTTCCACGTCTTTCTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004927.2-272s1c1
Sequence:CCGGCCAAAGCATGAACATTATCCTCTCGAGAGGATAATGTTCATGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-327s21c1
Sequence:CCGGCACCCAACCTGCCTTACTTTGCTCGAGCAAAGTAAGGCAGGTTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-205s21c1
Sequence:CCGGTGTGGAGTCTGTGGATGAATACTCGAGTATTCATCCACAGACTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-974s21c1
Sequence:CCGGCCTCTTGAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004927.2-449s21c1
Sequence:CCGGCTGCAGAAAGACGTGGAAGATCTCGAGATCTTCCACGTCTTTCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004927.2-1910s21c1
Sequence:CCGGCCTGGAGATTCCATTCCATTTCTCGAGAAATGGAATGGAATCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)