EMAIL THIS PAGE TO A FRIEND

MRPL4

mitochondrial ribosomal protein L4

93 Gene Product Result for
Synonyms: CGI-28 L4mt
UniProtKB ID: Q9BYD3, A6NNV7, Q9BW07, Q9H4N2, Q9Y317
Gene ID:
Human(51073) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified alternatively spliced variants that encode different protein isoforms. [provided by RefSeq, Jul 2008]
Mouse(66163) mitochondrial ribosomal protein L4
Rat(363023) mitochondrial ribosomal protein L4
fruit fly(49425) mitochondrial ribosomal protein L4
domestic cat(101089171) mitochondrial ribosomal protein L4
cow(507154) mitochondrial ribosomal protein L4
dog(611273) mitochondrial ribosomal protein L4
naked mole-rat(101713321) mitochondrial ribosomal protein L4
domestic guinea pig(100714432) mitochondrial ribosomal protein L4
sheep(101112311) mitochondrial ribosomal protein L4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_146387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_146387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015956 Rosetta Predictions human pricing
NM_146387 Rosetta Predictions human pricing
NM_146388 Rosetta Predictions human pricing
NM_001108754 Rosetta Predictions rat pricing
NM_023167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240698 predicted 792
2 SASI_Hs01_00240699 predicted 439
3 SASI_Hs02_00348600 predicted 583
4 SASI_Hs02_00348601 predicted 793
5 SASI_Hs02_00348602 predicted 661
6 SASI_Hs02_00348603 predicted 559
7 SASI_Hs01_00240703 predicted 562
8 SASI_Hs01_00240704 predicted 764
9 SASI_Hs02_00348604 predicted 803
10 SASI_Hs02_00348605 predicted 415
11 SASI_Hs01_00240696 predicted 553
12 SASI_Hs01_00240697 predicted 416
13 SASI_Hs01_00240700 predicted 662
14 SASI_Hs01_00240701 predicted 475
15 SASI_Hs01_00240702 predicted 697
16 SASI_Hs01_00240705 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012786 predicted 656
2 SASI_Hs01_00012787 predicted 306
3 SASI_Hs02_00365454 predicted 448
4 SASI_Hs02_00365455 predicted 652
5 SASI_Hs02_00365456 predicted 522
6 SASI_Hs02_00365457 predicted 422
7 SASI_Hs01_00012791 predicted 426
8 SASI_Hs01_00012792 predicted 631
9 SASI_Hs02_00365458 predicted 670
10 SASI_Hs02_00365459 predicted 286
11 SASI_Hs01_00012784 predicted 422
12 SASI_Hs01_00012785 predicted 288
13 SASI_Hs01_00012788 predicted 523
14 SASI_Hs01_00012789 predicted 334
15 SASI_Hs01_00012790 predicted 557
16 SASI_Hs01_00012793 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169525 predicted 795
2 SASI_Hs01_00169526 predicted 441
3 SASI_Hs02_00365460 predicted 583
4 SASI_Hs02_00365461 predicted 787
5 SASI_Hs02_00365462 predicted 654
6 SASI_Hs02_00365463 predicted 552
7 SASI_Hs01_00169530 predicted 562
8 SASI_Hs01_00169531 predicted 766
9 SASI_Hs02_00365464 predicted 801
10 SASI_Hs02_00365465 predicted 420
11 SASI_Hs01_00169523 predicted 556
12 SASI_Hs01_00169524 predicted 425
13 SASI_Hs01_00169527 predicted 658
14 SASI_Hs01_00169528 predicted 467
15 SASI_Hs01_00169529 predicted 696
16 SASI_Hs01_00169532 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241755 predicted 838
2 SASI_Rn02_00241756 predicted 664
3 SASI_Rn02_00241757 predicted 1289
4 SASI_Rn02_00241758 predicted 329
5 SASI_Rn02_00241759 predicted 1285
6 SASI_Rn02_00241760 predicted 834
7 SASI_Rn02_00241761 predicted 342
8 SASI_Rn02_00241762 predicted 236
9 SASI_Rn02_00241763 predicted 1163
10 SASI_Rn02_00241764 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052194 predicted 841
2 SASI_Mm01_00052195 predicted 668
3 SASI_Mm01_00052196 predicted 839
4 SASI_Mm01_00052198 predicted 849
5 SASI_Mm01_00052199 predicted 668
6 SASI_Mm01_00052200 predicted 612
7 SASI_Mm02_00326888 predicted 244
8 SASI_Mm02_00326889 predicted 383
9 SASI_Mm02_00326890 predicted 1002
10 SASI_Mm02_00326891 predicted 323
11 SASI_Mm01_00052197 predicted 603
12 SASI_Mm01_00052201 predicted 382
13 SASI_Mm01_00052202 predicted 506
14 SASI_Mm01_00052203 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146387
VALIDATED
MRPL4 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_146387.1-628s1c1
Sequence:CCGGCACAAGTTACTACTACATGCTCTCGAGAGCATGTAGTAGTAACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146387.1-856s1c1
Sequence:CCGGCTCTAGGCTTAAGACCTTCAACTCGAGTTGAAGGTCTTAAGCCTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146387.1-713s1c1
Sequence:CCGGCTGCACATCATGGACTCCCTACTCGAGTAGGGAGTCCATGATGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_146387.1-472s1c1
Sequence:CCGGCAAGAGAATTAGCTATGCCAACTCGAGTTGGCATAGCTAATTCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-628s21c1
Sequence:CCGGCACAAGTTACTACTACATGCTCTCGAGAGCATGTAGTAGTAACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146387.1-856s21c1
Sequence:CCGGCTCTAGGCTTAAGACCTTCAACTCGAGTTGAAGGTCTTAAGCCTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-1183s21c1
Sequence:CCGGCCCTTCATTCCACGGAGGAAGCTCGAGCTTCCTCCGTGGAATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-881s21c1
Sequence:CCGGATCCCGGCTGTTGGCCTAAATCTCGAGATTTAGGCCAACAGCCGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-798s21c1
Sequence:CCGGCCGTACTCCTCGTGGACTTAACTCGAGTTAAGTCCACGAGGAGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146387
VALIDATED
MRPL4 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_146387.1-628s1c1
Sequence:CCGGCACAAGTTACTACTACATGCTCTCGAGAGCATGTAGTAGTAACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146387.1-856s1c1
Sequence:CCGGCTCTAGGCTTAAGACCTTCAACTCGAGTTGAAGGTCTTAAGCCTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146387.1-713s1c1
Sequence:CCGGCTGCACATCATGGACTCCCTACTCGAGTAGGGAGTCCATGATGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_146387.1-472s1c1
Sequence:CCGGCAAGAGAATTAGCTATGCCAACTCGAGTTGGCATAGCTAATTCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-628s21c1
Sequence:CCGGCACAAGTTACTACTACATGCTCTCGAGAGCATGTAGTAGTAACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146387.1-856s21c1
Sequence:CCGGCTCTAGGCTTAAGACCTTCAACTCGAGTTGAAGGTCTTAAGCCTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-1183s21c1
Sequence:CCGGCCCTTCATTCCACGGAGGAAGCTCGAGCTTCCTCCGTGGAATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-881s21c1
Sequence:CCGGATCCCGGCTGTTGGCCTAAATCTCGAGATTTAGGCCAACAGCCGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-798s21c1
Sequence:CCGGCCGTACTCCTCGTGGACTTAACTCGAGTTAAGTCCACGAGGAGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146387
VALIDATED
MRPL4 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_146387.1-628s1c1
Sequence:CCGGCACAAGTTACTACTACATGCTCTCGAGAGCATGTAGTAGTAACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146387.1-856s1c1
Sequence:CCGGCTCTAGGCTTAAGACCTTCAACTCGAGTTGAAGGTCTTAAGCCTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146387.1-713s1c1
Sequence:CCGGCTGCACATCATGGACTCCCTACTCGAGTAGGGAGTCCATGATGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_146387.1-472s1c1
Sequence:CCGGCAAGAGAATTAGCTATGCCAACTCGAGTTGGCATAGCTAATTCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-628s21c1
Sequence:CCGGCACAAGTTACTACTACATGCTCTCGAGAGCATGTAGTAGTAACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146387.1-856s21c1
Sequence:CCGGCTCTAGGCTTAAGACCTTCAACTCGAGTTGAAGGTCTTAAGCCTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-1183s21c1
Sequence:CCGGCCCTTCATTCCACGGAGGAAGCTCGAGCTTCCTCCGTGGAATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-881s21c1
Sequence:CCGGATCCCGGCTGTTGGCCTAAATCTCGAGATTTAGGCCAACAGCCGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_146387.1-798s21c1
Sequence:CCGGCCGTACTCCTCGTGGACTTAACTCGAGTTAAGTCCACGAGGAGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023167
VALIDATED
MRPL4 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023167.2-810s21c1
Sequence:CCGGCCTGACAGAGTTGGCCCAGTACTCGAGTACTGGGCCAACTCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023167.1-843s1c1
Sequence:CCGGCCTGCCCTGGTCACCTAGGGACTCGAGTCCCTAGGTGACCAGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-562s1c1
Sequence:CCGGCCTGACAGAGTTGGCCCAGTACTCGAGTACTGGGCCAACTCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-427s1c1
Sequence:CCGGTCCTACAAGTTACTACTACATCTCGAGATGTAGTAGTAACTTGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-600s1c1
Sequence:CCGGCCGTGCTCCTTGTAGACTTAACTCGAGTTAAGTCTACAAGGAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-787s1c1
Sequence:CCGGCTCAAGATACACTCCGCTCTACTCGAGTAGAGCGGAGTGTATCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023167.2-675s21c1
Sequence:CCGGTCCTACAAGTTACTACTACATCTCGAGATGTAGTAGTAACTTGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023167.2-1091s21c1
Sequence:CCGGCCTGCCCTGGTCACCTAGGGACTCGAGTCCCTAGGTGACCAGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023167.2-1035s21c1
Sequence:CCGGCTCAAGATACACTCCGCTCTACTCGAGTAGAGCGGAGTGTATCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023167
VALIDATED
MRPL4 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023167.2-810s21c1
Sequence:CCGGCCTGACAGAGTTGGCCCAGTACTCGAGTACTGGGCCAACTCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023167.1-843s1c1
Sequence:CCGGCCTGCCCTGGTCACCTAGGGACTCGAGTCCCTAGGTGACCAGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-562s1c1
Sequence:CCGGCCTGACAGAGTTGGCCCAGTACTCGAGTACTGGGCCAACTCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-427s1c1
Sequence:CCGGTCCTACAAGTTACTACTACATCTCGAGATGTAGTAGTAACTTGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-600s1c1
Sequence:CCGGCCGTGCTCCTTGTAGACTTAACTCGAGTTAAGTCTACAAGGAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-787s1c1
Sequence:CCGGCTCAAGATACACTCCGCTCTACTCGAGTAGAGCGGAGTGTATCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023167.2-675s21c1
Sequence:CCGGTCCTACAAGTTACTACTACATCTCGAGATGTAGTAGTAACTTGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023167.2-1091s21c1
Sequence:CCGGCCTGCCCTGGTCACCTAGGGACTCGAGTCCCTAGGTGACCAGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023167.2-1035s21c1
Sequence:CCGGCTCAAGATACACTCCGCTCTACTCGAGTAGAGCGGAGTGTATCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023167
VALIDATED
MRPL4 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023167.2-810s21c1
Sequence:CCGGCCTGACAGAGTTGGCCCAGTACTCGAGTACTGGGCCAACTCTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023167.1-843s1c1
Sequence:CCGGCCTGCCCTGGTCACCTAGGGACTCGAGTCCCTAGGTGACCAGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-562s1c1
Sequence:CCGGCCTGACAGAGTTGGCCCAGTACTCGAGTACTGGGCCAACTCTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-427s1c1
Sequence:CCGGTCCTACAAGTTACTACTACATCTCGAGATGTAGTAGTAACTTGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-600s1c1
Sequence:CCGGCCGTGCTCCTTGTAGACTTAACTCGAGTTAAGTCTACAAGGAGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023167.1-787s1c1
Sequence:CCGGCTCAAGATACACTCCGCTCTACTCGAGTAGAGCGGAGTGTATCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023167.2-675s21c1
Sequence:CCGGTCCTACAAGTTACTACTACATCTCGAGATGTAGTAGTAACTTGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023167.2-1091s21c1
Sequence:CCGGCCTGCCCTGGTCACCTAGGGACTCGAGTCCCTAGGTGACCAGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023167.2-1035s21c1
Sequence:CCGGCTCAAGATACACTCCGCTCTACTCGAGTAGAGCGGAGTGTATCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)