EMAIL THIS PAGE TO A FRIEND

MRPL50

mitochondrial ribosomal protein L50

53 Gene Product Result for
Synonyms: MRP-L50
UniProtKB ID: Q8N5N7, Q5T7E0, Q9NX15
Gene ID:
Human(54534) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a putative 39S subunit protein and belongs to the L47P ribosomal protein family. Pseudogenes corresponding to this gene are found on chromosomes 2p, 2q, 5p, and 10q. [provided by RefSeq, Jul 2008]
Mouse(28028) mitochondrial ribosomal protein L50
Rat(362517) mitochondrial ribosomal protein L50
fruit fly(38796) mitochondrial ribosomal protein L50
cow(514753) mitochondrial ribosomal protein L50
domestic cat(101096362) mitochondrial ribosomal protein L50
dog(474785) mitochondrial ribosomal protein L50
chicken(427307) mitochondrial ribosomal protein L50
domestic guinea pig(100716642) mitochondrial ribosomal protein L50
naked mole-rat(101714730) mitochondrial ribosomal protein L50
sheep(101122162) mitochondrial ribosomal protein L50
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019051 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159341 MISSION® esiRNA esiRNA human MRPL50 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019051 Rosetta Predictions human pricing
NM_001108665 Rosetta Predictions rat pricing
NM_178603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077789 predicted 393
2 SASI_Hs01_00077790 predicted 314
3 SASI_Hs01_00077791 predicted 240
4 SASI_Hs02_00352621 predicted 306
5 SASI_Hs01_00077792 predicted 439
6 SASI_Hs01_00077794 predicted 314
7 SASI_Hs02_00352622 predicted 253
8 SASI_Hs02_00352623 predicted 244
9 SASI_Hs02_00352624 predicted 211
10 SASI_Hs02_00352625 predicted 287
11 SASI_Hs01_00077788 predicted 301
12 SASI_Hs01_00077793 predicted 257
13 SASI_Hs01_00077795 predicted 383
14 SASI_Hs01_00077796 predicted 293
15 SASI_Hs01_00077797 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240865 predicted 922
2 SASI_Rn02_00240866 predicted 302
3 SASI_Rn02_00240867 predicted 887
4 SASI_Rn02_00240868 predicted 319
5 SASI_Rn02_00240869 predicted 379
6 SASI_Rn02_00240870 predicted 214
7 SASI_Rn02_00240871 predicted 871
8 SASI_Rn02_00240872 predicted 324
9 SASI_Rn02_00240873 predicted 966
10 SASI_Rn02_00240874 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173372 predicted 278
2 SASI_Mm01_00173373 predicted 971
3 SASI_Mm01_00173374 predicted 878
4 SASI_Mm01_00173375 predicted 365
5 SASI_Mm01_00173376 predicted 298
6 SASI_Mm01_00173377 predicted 313
7 SASI_Mm02_00348944 predicted 203
8 SASI_Mm01_00173378 predicted 230
9 SASI_Mm01_00173379 predicted 270
10 SASI_Mm01_00173380 predicted 324
11 SASI_Mm01_00173381 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178603
VALIDATED
MRPL50 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L50
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178603.4-456s21c1
Sequence:CCGGTGAACTCGTTGCTAGTAATTTCTCGAGAAATTACTAGCAACGAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178603.4-237s21c1
Sequence:CCGGTCGCTTGGAATCTCATATTAACTCGAGTTAATATGAGATTCCAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178603.4-267s21c1
Sequence:CCGGTGGTTCATCTCTTCCTAATAACTCGAGTTATTAGGAAGAGATGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178603.4-1279s1c1
Sequence:CCGGCTTTGCCTGTCATACGGTTAACTCGAGTTAACCGTATGACAGGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.4-454s1c1
Sequence:CCGGGATGAACTCGTTGCTAGTAATCTCGAGATTACTAGCAACGAGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178603.4-1280s21c1
Sequence:CCGGTTTGCCTGTCATACGGTTAAACTCGAGTTTAACCGTATGACAGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178603.4-300s21c1
Sequence:CCGGCTCCCTGGATGATGGACATATCTCGAGATATGTCCATCATCCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.2-233s1c1
Sequence:CCGGCAGAGTCGCTTGGAATCTCATCTCGAGATGAGATTCCAAGCGACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.2-325s1c1
Sequence:CCGGGTTCAGACTCTTAGCAGGCTTCTCGAGAAGCCTGCTAAGAGTCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.2-304s1c1
Sequence:CCGGCCTGGATGATGGACATATGAACTCGAGTTCATATGTCCATCATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178603
VALIDATED
MRPL50 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L50
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178603.4-456s21c1
Sequence:CCGGTGAACTCGTTGCTAGTAATTTCTCGAGAAATTACTAGCAACGAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178603.4-237s21c1
Sequence:CCGGTCGCTTGGAATCTCATATTAACTCGAGTTAATATGAGATTCCAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178603.4-267s21c1
Sequence:CCGGTGGTTCATCTCTTCCTAATAACTCGAGTTATTAGGAAGAGATGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178603.4-1279s1c1
Sequence:CCGGCTTTGCCTGTCATACGGTTAACTCGAGTTAACCGTATGACAGGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.4-454s1c1
Sequence:CCGGGATGAACTCGTTGCTAGTAATCTCGAGATTACTAGCAACGAGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178603.4-1280s21c1
Sequence:CCGGTTTGCCTGTCATACGGTTAAACTCGAGTTTAACCGTATGACAGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178603.4-300s21c1
Sequence:CCGGCTCCCTGGATGATGGACATATCTCGAGATATGTCCATCATCCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.2-233s1c1
Sequence:CCGGCAGAGTCGCTTGGAATCTCATCTCGAGATGAGATTCCAAGCGACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.2-325s1c1
Sequence:CCGGGTTCAGACTCTTAGCAGGCTTCTCGAGAAGCCTGCTAAGAGTCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.2-304s1c1
Sequence:CCGGCCTGGATGATGGACATATGAACTCGAGTTCATATGTCCATCATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178603
VALIDATED
MRPL50 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L50
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178603.4-456s21c1
Sequence:CCGGTGAACTCGTTGCTAGTAATTTCTCGAGAAATTACTAGCAACGAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178603.4-237s21c1
Sequence:CCGGTCGCTTGGAATCTCATATTAACTCGAGTTAATATGAGATTCCAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178603.4-267s21c1
Sequence:CCGGTGGTTCATCTCTTCCTAATAACTCGAGTTATTAGGAAGAGATGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178603.4-1279s1c1
Sequence:CCGGCTTTGCCTGTCATACGGTTAACTCGAGTTAACCGTATGACAGGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.4-454s1c1
Sequence:CCGGGATGAACTCGTTGCTAGTAATCTCGAGATTACTAGCAACGAGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178603.4-1280s21c1
Sequence:CCGGTTTGCCTGTCATACGGTTAAACTCGAGTTTAACCGTATGACAGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178603.4-300s21c1
Sequence:CCGGCTCCCTGGATGATGGACATATCTCGAGATATGTCCATCATCCAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.2-233s1c1
Sequence:CCGGCAGAGTCGCTTGGAATCTCATCTCGAGATGAGATTCCAAGCGACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.2-325s1c1
Sequence:CCGGGTTCAGACTCTTAGCAGGCTTCTCGAGAAGCCTGCTAAGAGTCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178603.2-304s1c1
Sequence:CCGGCCTGGATGATGGACATATGAACTCGAGTTCATATGTCCATCATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019051
VALIDATED
MRPL50 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L50
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-281s21c1
Sequence:CCGGGTTCATCTCTTCCTAGTAATTCTCGAGAATTACTAGGAAGAGATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-860s21c1
Sequence:CCGGTCATCCTGTTAGGATTCATATCTCGAGATATGAATCCTAACAGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-442s21c1
Sequence:CCGGCCTATTCAAGATAGATCTAAACTCGAGTTTAGATCTATCTTGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-190s21c1
Sequence:CCGGATCCTAGTGTGTCCACCTTTACTCGAGTAAAGGTGGACACACTAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-250s21c1
Sequence:CCGGCGTTTGGAATCTTACGTTAAACTCGAGTTTAACGTAAGATTCCAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019051.1-873s1c1
Sequence:CCGGGCATTGCACATACACAAATAACTCGAGTTATTTGTGTATGTGCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019051.1-258s1c1
Sequence:CCGGGTTCATCTCTTCCTAGTAATTCTCGAGAATTACTAGGAAGAGATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019051.1-299s1c1
Sequence:CCGGGATAGTCGTCTAAAGTTCAATCTCGAGATTGAACTTTAGACGACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019051
VALIDATED
MRPL50 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L50
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-281s21c1
Sequence:CCGGGTTCATCTCTTCCTAGTAATTCTCGAGAATTACTAGGAAGAGATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-860s21c1
Sequence:CCGGTCATCCTGTTAGGATTCATATCTCGAGATATGAATCCTAACAGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-442s21c1
Sequence:CCGGCCTATTCAAGATAGATCTAAACTCGAGTTTAGATCTATCTTGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-190s21c1
Sequence:CCGGATCCTAGTGTGTCCACCTTTACTCGAGTAAAGGTGGACACACTAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-250s21c1
Sequence:CCGGCGTTTGGAATCTTACGTTAAACTCGAGTTTAACGTAAGATTCCAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019051.1-873s1c1
Sequence:CCGGGCATTGCACATACACAAATAACTCGAGTTATTTGTGTATGTGCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019051.1-258s1c1
Sequence:CCGGGTTCATCTCTTCCTAGTAATTCTCGAGAATTACTAGGAAGAGATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019051.1-299s1c1
Sequence:CCGGGATAGTCGTCTAAAGTTCAATCTCGAGATTGAACTTTAGACGACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019051
VALIDATED
MRPL50 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L50
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-281s21c1
Sequence:CCGGGTTCATCTCTTCCTAGTAATTCTCGAGAATTACTAGGAAGAGATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-860s21c1
Sequence:CCGGTCATCCTGTTAGGATTCATATCTCGAGATATGAATCCTAACAGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-442s21c1
Sequence:CCGGCCTATTCAAGATAGATCTAAACTCGAGTTTAGATCTATCTTGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-190s21c1
Sequence:CCGGATCCTAGTGTGTCCACCTTTACTCGAGTAAAGGTGGACACACTAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_019051.2-250s21c1
Sequence:CCGGCGTTTGGAATCTTACGTTAAACTCGAGTTTAACGTAAGATTCCAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019051.1-873s1c1
Sequence:CCGGGCATTGCACATACACAAATAACTCGAGTTATTTGTGTATGTGCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019051.1-258s1c1
Sequence:CCGGGTTCATCTCTTCCTAGTAATTCTCGAGAATTACTAGGAAGAGATGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019051.1-299s1c1
Sequence:CCGGGATAGTCGTCTAAAGTTCAATCTCGAGATTGAACTTTAGACGACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)