EMAIL THIS PAGE TO A FRIEND

MRPL51

mitochondrial ribosomal protein L51

45 Gene Product Result for
Synonyms: HSPC241 MRP64 bMRP64
UniProtKB ID: Q4U2R6, Q96Q57, Q9BQ36, Q9P0N7
Gene ID:
Human(51258) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Pseudogenes corresponding to this gene are found on chromosomes 4p and 21q. [provided by RefSeq, Jul 2008]
Mouse(66493) mitochondrial ribosomal protein L51
Rat(297601) mitochondrial ribosomal protein L51
fruit fly(34186) mitochondrial ribosomal protein L51
cow(513622) mitochondrial ribosomal protein L51
domestic cat(101081391) mitochondrial ribosomal protein L51
chicken(418274) mitochondrial ribosomal protein L51
dog(100687415) mitochondrial ribosomal protein L51
sheep(101113486) mitochondrial ribosomal protein L51
naked mole-rat(101703593) mitochondrial ribosomal protein L51
domestic guinea pig(100729226) mitochondrial ribosomal protein L51
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016497 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016497 Rosetta Predictions human pricing
NM_001106621 Rosetta Predictions rat pricing
NM_025595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208850 predicted 422
2 SASI_Hs02_00349562 predicted 315
3 SASI_Hs01_00208851 predicted 413
4 SASI_Hs01_00208852 predicted 345
5 SASI_Hs01_00208854 predicted 296
6 SASI_Hs01_00208855 predicted 315
7 SASI_Hs01_00208856 predicted 236
8 SASI_Hs01_00208857 predicted 398
9 SASI_Hs01_00208858 predicted 215
10 SASI_Hs01_00208859 predicted 320
11 SASI_Hs01_00208853 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220748 predicted 963
2 SASI_Rn02_00220749 predicted 1174
3 SASI_Rn02_00220750 predicted 956
4 SASI_Rn02_00220751 predicted 1144
5 SASI_Rn02_00220752 predicted 1095
6 SASI_Rn02_00220753 predicted 817
7 SASI_Rn02_00220754 predicted 926
8 SASI_Rn02_00220755 predicted 1150
9 SASI_Rn02_00220756 predicted 956
10 SASI_Rn02_00220757 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328590 predicted 444
2 SASI_Mm02_00328591 predicted 300
3 SASI_Mm02_00328592 predicted 472
4 SASI_Mm02_00328593 predicted 500
5 SASI_Mm02_00328594 predicted 362
6 SASI_Mm02_00328595 predicted 486
7 SASI_Mm02_00328596 predicted 577
8 SASI_Mm02_00328597 predicted 530
9 SASI_Mm02_00328598 predicted 275
10 SASI_Mm02_00328599 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025595
VALIDATED
MRPL51 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L51
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025595.1-734s1c1
Sequence:CCGGCCAGTTATGCTTGTGGCCTTTCTCGAGAAAGGCCACAAGCATAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-320s1c1
Sequence:CCGGCGTCTACGACAACATTGGAATCTCGAGATTCCAATGTTGTCGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-249s1c1
Sequence:CCGGGCCTTCGTAAGGCTCACTCTTCTCGAGAAGAGTGAGCCTTACGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-476s1c1
Sequence:CCGGGCATAACCTTAACAAACGGATCTCGAGATCCGTTTGTTAAGGTTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-492s1c1
Sequence:CCGGCGGATCAGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-492s21c1
Sequence:CCGGCGGATCAGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-320s21c1
Sequence:CCGGCGTCTACGACAACATTGGAATCTCGAGATTCCAATGTTGTCGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-249s21c1
Sequence:CCGGGCCTTCGTAAGGCTCACTCTTCTCGAGAAGAGTGAGCCTTACGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-476s21c1
Sequence:CCGGGCATAACCTTAACAAACGGATCTCGAGATCCGTTTGTTAAGGTTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025595
VALIDATED
MRPL51 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L51
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025595.1-734s1c1
Sequence:CCGGCCAGTTATGCTTGTGGCCTTTCTCGAGAAAGGCCACAAGCATAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-320s1c1
Sequence:CCGGCGTCTACGACAACATTGGAATCTCGAGATTCCAATGTTGTCGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-249s1c1
Sequence:CCGGGCCTTCGTAAGGCTCACTCTTCTCGAGAAGAGTGAGCCTTACGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-476s1c1
Sequence:CCGGGCATAACCTTAACAAACGGATCTCGAGATCCGTTTGTTAAGGTTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-492s1c1
Sequence:CCGGCGGATCAGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-492s21c1
Sequence:CCGGCGGATCAGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-320s21c1
Sequence:CCGGCGTCTACGACAACATTGGAATCTCGAGATTCCAATGTTGTCGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-249s21c1
Sequence:CCGGGCCTTCGTAAGGCTCACTCTTCTCGAGAAGAGTGAGCCTTACGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-476s21c1
Sequence:CCGGGCATAACCTTAACAAACGGATCTCGAGATCCGTTTGTTAAGGTTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025595
VALIDATED
MRPL51 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L51
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025595.1-734s1c1
Sequence:CCGGCCAGTTATGCTTGTGGCCTTTCTCGAGAAAGGCCACAAGCATAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-320s1c1
Sequence:CCGGCGTCTACGACAACATTGGAATCTCGAGATTCCAATGTTGTCGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-249s1c1
Sequence:CCGGGCCTTCGTAAGGCTCACTCTTCTCGAGAAGAGTGAGCCTTACGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-476s1c1
Sequence:CCGGGCATAACCTTAACAAACGGATCTCGAGATCCGTTTGTTAAGGTTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025595.1-492s1c1
Sequence:CCGGCGGATCAGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-492s21c1
Sequence:CCGGCGGATCAGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-320s21c1
Sequence:CCGGCGTCTACGACAACATTGGAATCTCGAGATTCCAATGTTGTCGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-249s21c1
Sequence:CCGGGCCTTCGTAAGGCTCACTCTTCTCGAGAAGAGTGAGCCTTACGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025595.3-476s21c1
Sequence:CCGGGCATAACCTTAACAAACGGATCTCGAGATCCGTTTGTTAAGGTTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016497
VALIDATED
MRPL51 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L51
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-492s1c1
Sequence:CCGGCGCATCCGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCGGATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016497.2-483s1c1
Sequence:CCGGCTTAATAAACGCATCCGCTATCTCGAGATAGCGGATGCGTTTATTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-423s1c1
Sequence:CCGGCGTTGTATCCGAAAGAGGAAACTCGAGTTTCCTCTTTCGGATACAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-396s1c1
Sequence:CCGGCGAGGTTGGAAAGGGAATGAACTCGAGTTCATTCCCTTTCCAACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-451s1c1
Sequence:CCGGGAAGTAGAATGTTCGCTGATGCTCGAGCATCAGCGAACATTCTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-314s1c1
Sequence:CCGGGTTCGGAGTGTATGACAACATCTCGAGATGTTGTCATACACTCCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016497.2-397s1c1
Sequence:CCGGGAGGTTGGAAAGGGAATGAATCTCGAGATTCATTCCCTTTCCAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-506s21c1
Sequence:CCGGCGCATCCGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-465s21c1
Sequence:CCGGGAAGTAGAATGTTCGCTGATGCTCGAGCATCAGCGAACATTCTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-328s21c1
Sequence:CCGGGTTCGGAGTGTATGACAACATCTCGAGATGTTGTCATACACTCCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-410s21c1
Sequence:CCGGCGAGGTTGGAAAGGGAATGAACTCGAGTTCATTCCCTTTCCAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-437s21c1
Sequence:CCGGCGTTGTATCCGAAAGAGGAAACTCGAGTTTCCTCTTTCGGATACAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016497
VALIDATED
MRPL51 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L51
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-492s1c1
Sequence:CCGGCGCATCCGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCGGATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016497.2-483s1c1
Sequence:CCGGCTTAATAAACGCATCCGCTATCTCGAGATAGCGGATGCGTTTATTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-423s1c1
Sequence:CCGGCGTTGTATCCGAAAGAGGAAACTCGAGTTTCCTCTTTCGGATACAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-396s1c1
Sequence:CCGGCGAGGTTGGAAAGGGAATGAACTCGAGTTCATTCCCTTTCCAACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-451s1c1
Sequence:CCGGGAAGTAGAATGTTCGCTGATGCTCGAGCATCAGCGAACATTCTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-314s1c1
Sequence:CCGGGTTCGGAGTGTATGACAACATCTCGAGATGTTGTCATACACTCCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016497.2-397s1c1
Sequence:CCGGGAGGTTGGAAAGGGAATGAATCTCGAGATTCATTCCCTTTCCAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-506s21c1
Sequence:CCGGCGCATCCGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-465s21c1
Sequence:CCGGGAAGTAGAATGTTCGCTGATGCTCGAGCATCAGCGAACATTCTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-328s21c1
Sequence:CCGGGTTCGGAGTGTATGACAACATCTCGAGATGTTGTCATACACTCCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-410s21c1
Sequence:CCGGCGAGGTTGGAAAGGGAATGAACTCGAGTTCATTCCCTTTCCAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-437s21c1
Sequence:CCGGCGTTGTATCCGAAAGAGGAAACTCGAGTTTCCTCTTTCGGATACAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016497
VALIDATED
MRPL51 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L51
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-492s1c1
Sequence:CCGGCGCATCCGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCGGATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016497.2-483s1c1
Sequence:CCGGCTTAATAAACGCATCCGCTATCTCGAGATAGCGGATGCGTTTATTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-423s1c1
Sequence:CCGGCGTTGTATCCGAAAGAGGAAACTCGAGTTTCCTCTTTCGGATACAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-396s1c1
Sequence:CCGGCGAGGTTGGAAAGGGAATGAACTCGAGTTCATTCCCTTTCCAACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-451s1c1
Sequence:CCGGGAAGTAGAATGTTCGCTGATGCTCGAGCATCAGCGAACATTCTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016497.2-314s1c1
Sequence:CCGGGTTCGGAGTGTATGACAACATCTCGAGATGTTGTCATACACTCCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016497.2-397s1c1
Sequence:CCGGGAGGTTGGAAAGGGAATGAATCTCGAGATTCATTCCCTTTCCAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-506s21c1
Sequence:CCGGCGCATCCGCTATCTCTACAAACTCGAGTTTGTAGAGATAGCGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-465s21c1
Sequence:CCGGGAAGTAGAATGTTCGCTGATGCTCGAGCATCAGCGAACATTCTACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-328s21c1
Sequence:CCGGGTTCGGAGTGTATGACAACATCTCGAGATGTTGTCATACACTCCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-410s21c1
Sequence:CCGGCGAGGTTGGAAAGGGAATGAACTCGAGTTCATTCCCTTTCCAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016497.3-437s21c1
Sequence:CCGGCGTTGTATCCGAAAGAGGAAACTCGAGTTTCCTCTTTCGGATACAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)