EMAIL THIS PAGE TO A FRIEND

MRPL53

mitochondrial ribosomal protein L53

49 Gene Product Result for
Synonyms: L53MT
UniProtKB ID: Q96EL3
Gene ID:
Human(116540) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 1p. [provided by RefSeq, Jul 2008]
Mouse(68499) mitochondrial ribosomal protein L53
Rat(362388) mitochondrial ribosomal protein L53
sheep(101118259) mitochondrial ribosomal protein L53
naked mole-rat(101698339) mitochondrial ribosomal protein L53
domestic guinea pig(100735739) mitochondrial ribosomal protein L53
fruit fly(3772367) mitochondrial ribosomal protein L53
cow(505728) mitochondrial ribosomal protein L53
domestic cat(101086471) mitochondrial ribosomal protein L53
dog(612261) mitochondrial ribosomal protein L53
chicken(420196) mitochondrial ribosomal protein L53
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA056185 Anti-MRPL53 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053050 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224301 MISSION® esiRNA esiRNA targeting human MRPL53 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053050 Rosetta Predictions human pricing
NM_001108635 Rosetta Predictions rat pricing
NM_026744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028501 predicted 252
2 SASI_Hs01_00028502 predicted 359
3 SASI_Hs01_00028503 predicted 253
4 SASI_Hs01_00028504 predicted 368
5 SASI_Hs01_00028506 predicted 259
6 SASI_Hs02_00361890 predicted 343
7 SASI_Hs01_00028507 predicted 363
8 SASI_Hs01_00028509 predicted 253
9 SASI_Hs02_00361891 predicted 220
10 SASI_Hs01_00028510 predicted 225
11 SASI_Hs01_00028505 predicted 269
12 SASI_Hs01_00028508 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240569 predicted 385
2 SASI_Rn02_00240570 predicted 342
3 SASI_Rn02_00240571 predicted 351
4 SASI_Rn02_00240572 predicted 347
5 SASI_Rn02_00240573 predicted 384
6 SASI_Rn02_00240574 predicted 378
7 SASI_Rn02_00240575 predicted 344
8 SASI_Rn02_00240576 predicted 309
9 SASI_Rn02_00240577 predicted 380
10 SASI_Rn02_00240578 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330790 predicted 349
2 SASI_Mm02_00330791 predicted 234
3 SASI_Mm01_00072533 predicted 373
4 SASI_Mm02_00330792 predicted 239
5 SASI_Mm02_00330793 predicted 361
6 SASI_Mm02_00330794 predicted 377
7 SASI_Mm01_00072538 predicted 379
8 SASI_Mm02_00330795 predicted 351
9 SASI_Mm01_00072542 predicted 199
10 SASI_Mm02_00330796 predicted 344
11 SASI_Mm01_00072534 predicted 1606
12 SASI_Mm01_00072535 predicted 1354
13 SASI_Mm01_00072536 predicted 1467
14 SASI_Mm01_00072537 predicted 1241
15 SASI_Mm01_00072539 predicted 1267
16 SASI_Mm01_00072540 predicted 1287
17 SASI_Mm01_00072541 predicted 1348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026744
VALIDATED
MRPL53 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L53
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-137s21c1
Sequence:CCGGACCAACCTCAACTGCTCTGTGCTCGAGCACAGAGCAGTTGAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-212s21c1
Sequence:CCGGGATGGGTATCGGCTGATTATGCTCGAGCATAATCAGCCGATACCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-249s21c1
Sequence:CCGGCCACTCAGGAAATGTTAAGTGCTCGAGCACTTAACATTTCCTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-54s21c1
Sequence:CCGGGAGTTCAGTTCTGCCCGTTTGCTCGAGCAAACGGGCAGAACTGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026744.1-44s1c1
Sequence:CCGGCAAGCTGGTTCGAGTTCAGTTCTCGAGAACTGAACTCGAACCAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026744.1-140s1c1
Sequence:CCGGCAACCTCAACTGCTCTGTGATCTCGAGATCACAGAGCAGTTGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026744.3-369s1c1
Sequence:CCGGGAAGAGTCCAACAACCAAATGCTCGAGCATTTGGTTGTTGGACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-368s21c1
Sequence:CCGGAGAAGAGTCCAACAACCAAATCTCGAGATTTGGTTGTTGGACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026744
VALIDATED
MRPL53 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L53
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-137s21c1
Sequence:CCGGACCAACCTCAACTGCTCTGTGCTCGAGCACAGAGCAGTTGAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-212s21c1
Sequence:CCGGGATGGGTATCGGCTGATTATGCTCGAGCATAATCAGCCGATACCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-249s21c1
Sequence:CCGGCCACTCAGGAAATGTTAAGTGCTCGAGCACTTAACATTTCCTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-54s21c1
Sequence:CCGGGAGTTCAGTTCTGCCCGTTTGCTCGAGCAAACGGGCAGAACTGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026744.1-44s1c1
Sequence:CCGGCAAGCTGGTTCGAGTTCAGTTCTCGAGAACTGAACTCGAACCAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026744.1-140s1c1
Sequence:CCGGCAACCTCAACTGCTCTGTGATCTCGAGATCACAGAGCAGTTGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026744.3-369s1c1
Sequence:CCGGGAAGAGTCCAACAACCAAATGCTCGAGCATTTGGTTGTTGGACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-368s21c1
Sequence:CCGGAGAAGAGTCCAACAACCAAATCTCGAGATTTGGTTGTTGGACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026744
VALIDATED
MRPL53 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L53
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-137s21c1
Sequence:CCGGACCAACCTCAACTGCTCTGTGCTCGAGCACAGAGCAGTTGAGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-212s21c1
Sequence:CCGGGATGGGTATCGGCTGATTATGCTCGAGCATAATCAGCCGATACCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-249s21c1
Sequence:CCGGCCACTCAGGAAATGTTAAGTGCTCGAGCACTTAACATTTCCTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-54s21c1
Sequence:CCGGGAGTTCAGTTCTGCCCGTTTGCTCGAGCAAACGGGCAGAACTGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026744.1-44s1c1
Sequence:CCGGCAAGCTGGTTCGAGTTCAGTTCTCGAGAACTGAACTCGAACCAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026744.1-140s1c1
Sequence:CCGGCAACCTCAACTGCTCTGTGATCTCGAGATCACAGAGCAGTTGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026744.3-369s1c1
Sequence:CCGGGAAGAGTCCAACAACCAAATGCTCGAGCATTTGGTTGTTGGACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026744.3-368s21c1
Sequence:CCGGAGAAGAGTCCAACAACCAAATCTCGAGATTTGGTTGTTGGACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053050
VALIDATED
MRPL53 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L53
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053050.3-347s21c1
Sequence:CCGGAGACGGGCATCGCCTGATTATCTCGAGATAATCAGGCGATGCCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_053050.3-195s21c1
Sequence:CCGGCAGTTCTGTCCCTTCGAGAAACTCGAGTTTCTCGAAGGGACAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_053050.3-259s21c1
Sequence:CCGGAGAAGGTCCGCTCCACTAATCCTCGAGGATTAGTGGAGCGGACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_053050.3-377s21c1
Sequence:CCGGTCATCTCACCGCTCTGGAAATCTCGAGATTTCCAGAGCGGTGAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053050.3-169s21c1
Sequence:CCGGTGCGGCCTGTCAAACAGGTTCCTCGAGGAACCTGTTTGACAGGCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053050
VALIDATED
MRPL53 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L53
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053050.3-347s21c1
Sequence:CCGGAGACGGGCATCGCCTGATTATCTCGAGATAATCAGGCGATGCCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_053050.3-195s21c1
Sequence:CCGGCAGTTCTGTCCCTTCGAGAAACTCGAGTTTCTCGAAGGGACAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_053050.3-259s21c1
Sequence:CCGGAGAAGGTCCGCTCCACTAATCCTCGAGGATTAGTGGAGCGGACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_053050.3-377s21c1
Sequence:CCGGTCATCTCACCGCTCTGGAAATCTCGAGATTTCCAGAGCGGTGAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053050.3-169s21c1
Sequence:CCGGTGCGGCCTGTCAAACAGGTTCCTCGAGGAACCTGTTTGACAGGCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053050
VALIDATED
MRPL53 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L53
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053050.3-347s21c1
Sequence:CCGGAGACGGGCATCGCCTGATTATCTCGAGATAATCAGGCGATGCCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_053050.3-195s21c1
Sequence:CCGGCAGTTCTGTCCCTTCGAGAAACTCGAGTTTCTCGAAGGGACAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_053050.3-259s21c1
Sequence:CCGGAGAAGGTCCGCTCCACTAATCCTCGAGGATTAGTGGAGCGGACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_053050.3-377s21c1
Sequence:CCGGTCATCTCACCGCTCTGGAAATCTCGAGATTTCCAGAGCGGTGAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053050.3-169s21c1
Sequence:CCGGTGCGGCCTGTCAAACAGGTTCCTCGAGGAACCTGTTTGACAGGCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)