EMAIL THIS PAGE TO A FRIEND

MRPL54

mitochondrial ribosomal protein L54

49 Gene Product Result for
Synonyms: L54mt MRP-L54
UniProtKB ID: Q6P161
Gene ID:
Human(116541) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(66047) mitochondrial ribosomal protein L54
Rat(299628) mitochondrial ribosomal protein L54
Zebrafish(100034614) mitochondrial ribosomal protein L54
fruit fly(37389) mitochondrial ribosomal protein L54
dog(485052) mitochondrial ribosomal protein L54
cow(511926) mitochondrial ribosomal protein L54
Horse(100052998) mitochondrial ribosomal protein L54
domestic cat(101098520) mitochondrial ribosomal protein L54
chicken(100859867) mitochondrial ribosomal protein L54
domestic guinea pig(100730024) mitochondrial ribosomal protein L54
naked mole-rat(101703573) mitochondrial ribosomal protein L54
sheep(101117668) mitochondrial ribosomal protein L54
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172251 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172251 Rosetta Predictions human pricing
NM_001106770 Rosetta Predictions rat pricing
NM_025317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018354 predicted 247
2 SASI_Hs01_00018355 predicted 296
3 SASI_Hs01_00018356 predicted 309
4 SASI_Hs01_00018358 predicted 300
5 SASI_Hs01_00018359 predicted 303
6 SASI_Hs01_00018360 predicted 235
7 SASI_Hs01_00018361 predicted 241
8 SASI_Hs01_00018362 predicted 239
9 SASI_Hs01_00018363 predicted 301
10 SASI_Hs02_00367966 predicted 401
11 SASI_Hs01_00018357 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222228 predicted 377
2 SASI_Rn02_00222229 predicted 377
3 SASI_Rn02_00222230 predicted 281
4 SASI_Rn02_00222231 predicted 380
5 SASI_Rn02_00222232 predicted 277
6 SASI_Rn02_00222233 predicted 284
7 SASI_Rn02_00222234 predicted 292
8 SASI_Rn02_00222235 predicted 355
9 SASI_Rn02_00222236 predicted 360
10 SASI_Rn02_00222237 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102307 predicted 368
2 SASI_Mm01_00102308 predicted 265
3 SASI_Mm01_00102309 predicted 271
4 SASI_Mm01_00102310 predicted 302
5 SASI_Mm01_00102311 predicted 304
6 SASI_Mm01_00102312 predicted 349
7 SASI_Mm01_00102313 predicted 302
8 SASI_Mm01_00102314 predicted 346
9 SASI_Mm01_00102315 predicted 363
10 SASI_Mm01_00102316 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172251
VALIDATED
MRPL54 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L54
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172251.2-137s21c1
Sequence:CCGGTATGCCAAGAAACCAGTTATGCTCGAGCATAACTGGTTTCTTGGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172251.2-298s21c1
Sequence:CCGGGGATGCTGAGTACCCTGAATGCTCGAGCATTCAGGGTACTCAGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172251.2-431s21c1
Sequence:CCGGAGCAAGAACAAGAGGTTGTAGCTCGAGCTACAACCTCTTGTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172251.2-251s21c1
Sequence:CCGGATGGGCGTCAACATCTACAAGCTCGAGCTTGTAGATGTTGACGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172251.2-227s21c1
Sequence:CCGGCCTGTCCAGCTCACCACATATCTCGAGATATGTGGTGAGCTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172251.1-124s1c1
Sequence:CCGGCGGGATTATGCCAAGAAACCACTCGAGTGGTTTCTTGGCATAATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172251.1-248s1c1
Sequence:CCGGGCGTCAACATCTACAAGGAAGCTCGAGCTTCCTTGTAGATGTTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172251.1-420s1c1
Sequence:CCGGGCTGAGCAAGAACAAGAGGTTCTCGAGAACCTCTTGTTCTTGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172251
VALIDATED
MRPL54 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L54
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172251.2-137s21c1
Sequence:CCGGTATGCCAAGAAACCAGTTATGCTCGAGCATAACTGGTTTCTTGGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172251.2-298s21c1
Sequence:CCGGGGATGCTGAGTACCCTGAATGCTCGAGCATTCAGGGTACTCAGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172251.2-431s21c1
Sequence:CCGGAGCAAGAACAAGAGGTTGTAGCTCGAGCTACAACCTCTTGTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172251.2-251s21c1
Sequence:CCGGATGGGCGTCAACATCTACAAGCTCGAGCTTGTAGATGTTGACGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172251.2-227s21c1
Sequence:CCGGCCTGTCCAGCTCACCACATATCTCGAGATATGTGGTGAGCTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172251.1-124s1c1
Sequence:CCGGCGGGATTATGCCAAGAAACCACTCGAGTGGTTTCTTGGCATAATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172251.1-248s1c1
Sequence:CCGGGCGTCAACATCTACAAGGAAGCTCGAGCTTCCTTGTAGATGTTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172251.1-420s1c1
Sequence:CCGGGCTGAGCAAGAACAAGAGGTTCTCGAGAACCTCTTGTTCTTGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172251
VALIDATED
MRPL54 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L54
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172251.2-137s21c1
Sequence:CCGGTATGCCAAGAAACCAGTTATGCTCGAGCATAACTGGTTTCTTGGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172251.2-298s21c1
Sequence:CCGGGGATGCTGAGTACCCTGAATGCTCGAGCATTCAGGGTACTCAGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172251.2-431s21c1
Sequence:CCGGAGCAAGAACAAGAGGTTGTAGCTCGAGCTACAACCTCTTGTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172251.2-251s21c1
Sequence:CCGGATGGGCGTCAACATCTACAAGCTCGAGCTTGTAGATGTTGACGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172251.2-227s21c1
Sequence:CCGGCCTGTCCAGCTCACCACATATCTCGAGATATGTGGTGAGCTGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172251.1-124s1c1
Sequence:CCGGCGGGATTATGCCAAGAAACCACTCGAGTGGTTTCTTGGCATAATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172251.1-248s1c1
Sequence:CCGGGCGTCAACATCTACAAGGAAGCTCGAGCTTCCTTGTAGATGTTGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172251.1-420s1c1
Sequence:CCGGGCTGAGCAAGAACAAGAGGTTCTCGAGAACCTCTTGTTCTTGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025317
MRPL54 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L54
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-123s1c1
Sequence:CCGGGATTCTCTATCCGGGAATATGCTCGAGCATATTCCCGGATAGAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-127s1c1
Sequence:CCGGCTCTATCCGGGAATATGCTAACTCGAGTTAGCATATTCCCGGATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-424s1c1
Sequence:CCGGGAGCAAGAACAAGAAGCTGTACTCGAGTACAGCTTCTTGTTCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-383s1c1
Sequence:CCGGCGACTACTTCGCAAACAGAATCTCGAGATTCTGTTTGCGAAGTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025317
MRPL54 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L54
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-123s1c1
Sequence:CCGGGATTCTCTATCCGGGAATATGCTCGAGCATATTCCCGGATAGAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-127s1c1
Sequence:CCGGCTCTATCCGGGAATATGCTAACTCGAGTTAGCATATTCCCGGATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-424s1c1
Sequence:CCGGGAGCAAGAACAAGAAGCTGTACTCGAGTACAGCTTCTTGTTCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-383s1c1
Sequence:CCGGCGACTACTTCGCAAACAGAATCTCGAGATTCTGTTTGCGAAGTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025317
MRPL54 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L54
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-123s1c1
Sequence:CCGGGATTCTCTATCCGGGAATATGCTCGAGCATATTCCCGGATAGAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-127s1c1
Sequence:CCGGCTCTATCCGGGAATATGCTAACTCGAGTTAGCATATTCCCGGATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-424s1c1
Sequence:CCGGGAGCAAGAACAAGAAGCTGTACTCGAGTACAGCTTCTTGTTCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025317.1-383s1c1
Sequence:CCGGCGACTACTTCGCAAACAGAATCTCGAGATTCTGTTTGCGAAGTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)