EMAIL THIS PAGE TO A FRIEND

MRPL55

mitochondrial ribosomal protein L55

126 Gene Product Result for
Synonyms: AAVG5835 L55nt MRP-L55 PRO19675
UniProtKB ID: Q7Z7F7, Q5TBY3, Q5TBY6, Q6UWI8
Gene ID:
Human(128308) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding two different isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008]
Mouse(67212) mitochondrial ribosomal protein L55
Rat(287356) mitochondrial ribosomal protein L55
sheep(101103231) mitochondrial ribosomal protein L55
naked mole-rat(101717340) mitochondrial ribosomal protein L55
domestic guinea pig(100727259) mitochondrial ribosomal protein L55
fruit fly(42290) mitochondrial ribosomal protein L55
cow(506657) mitochondrial ribosomal protein L55
domestic cat(101099774) mitochondrial ribosomal protein L55
dog(607317) mitochondrial ribosomal protein L55
chicken(100858219) mitochondrial ribosomal protein L55
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181441 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181441 Rosetta Predictions human pricing
NM_181454 Rosetta Predictions human pricing
NM_181455 Rosetta Predictions human pricing
NM_181456 Rosetta Predictions human pricing
NM_181462 Rosetta Predictions human pricing
NM_181463 Rosetta Predictions human pricing
NM_181464 Rosetta Predictions human pricing
NM_181465 Rosetta Predictions human pricing
NM_001105782 Rosetta Predictions rat pricing
NM_026035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191744 predicted 429
2 SASI_Hs01_00191745 predicted 353
3 SASI_Hs01_00191747 predicted 430
4 SASI_Hs01_00191748 predicted 328
5 SASI_Hs01_00191749 predicted 437
6 SASI_Hs01_00191750 predicted 446
7 SASI_Hs01_00191751 predicted 344
8 SASI_Hs01_00191752 predicted 284
9 SASI_Hs01_00191753 predicted 352
10 SASI_Hs02_00370053 predicted 329
11 SASI_Hs01_00191746 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120102 predicted 428
2 SASI_Hs01_00120103 predicted 430
3 SASI_Hs01_00120104 predicted 422
4 SASI_Hs01_00120105 predicted 428
5 SASI_Hs01_00120106 predicted 444
6 SASI_Hs01_00120107 predicted 431
7 SASI_Hs01_00120108 predicted 392
8 SASI_Hs01_00120109 predicted 379
9 SASI_Hs01_00120110 predicted 429
10 SASI_Hs01_00120111 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241446 predicted 433
2 SASI_Hs01_00241447 predicted 435
3 SASI_Hs01_00241448 predicted 427
4 SASI_Hs01_00241449 predicted 437
5 SASI_Hs01_00241450 predicted 448
6 SASI_Hs01_00241451 predicted 431
7 SASI_Hs01_00241452 predicted 401
8 SASI_Hs01_00241453 predicted 388
9 SASI_Hs01_00241454 predicted 430
10 SASI_Hs01_00241455 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046558 predicted 475
2 SASI_Hs01_00046559 predicted 469
3 SASI_Hs01_00046560 predicted 465
4 SASI_Hs01_00046561 predicted 477
5 SASI_Hs01_00046562 predicted 484
6 SASI_Hs01_00046563 predicted 475
7 SASI_Hs01_00046564 predicted 434
8 SASI_Hs01_00046565 predicted 423
9 SASI_Hs01_00046566 predicted 474
10 SASI_Hs01_00046567 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370089 predicted 604
2 SASI_Hs02_00370090 predicted 519
3 SASI_Hs02_00370091 predicted 334
4 SASI_Hs02_00370092 predicted 599
5 SASI_Hs02_00370093 predicted 507
6 SASI_Hs01_00069029 predicted 618
7 SASI_Hs01_00069030 predicted 626
8 SASI_Hs02_00370094 predicted 522
9 SASI_Hs02_00370095 predicted 342
10 SASI_Hs02_00370096 predicted 463
11 SASI_Hs01_00069031 predicted 816
12 SASI_Hs01_00069032 predicted 807
13 SASI_Hs01_00069033 predicted 657
14 SASI_Hs01_00069034 predicted 823
15 SASI_Hs01_00069035 predicted 821
16 SASI_Hs01_00069036 predicted 742
17 SASI_Hs01_00069037 predicted 745
18 SASI_Hs01_00069038 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231992 predicted 505
2 SASI_Hs01_00231993 predicted 420
3 SASI_Hs01_00231995 predicted 492
4 SASI_Hs01_00231996 predicted 398
5 SASI_Hs01_00231997 predicted 504
6 SASI_Hs01_00231998 predicted 519
7 SASI_Hs01_00231999 predicted 410
8 SASI_Hs01_00232000 predicted 357
9 SASI_Hs01_00232001 predicted 424
10 SASI_Hs02_00370097 predicted 392
11 SASI_Hs01_00231994 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100152 predicted 389
2 SASI_Hs01_00100153 predicted 304
3 SASI_Hs01_00100155 predicted 384
4 SASI_Hs01_00100156 predicted 282
5 SASI_Hs01_00100157 predicted 390
6 SASI_Hs01_00100158 predicted 406
7 SASI_Hs01_00100159 predicted 299
8 SASI_Hs01_00100160 predicted 244
9 SASI_Hs01_00100161 predicted 303
10 SASI_Hs02_00370098 predicted 277
11 SASI_Hs01_00100154 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151158 predicted 318
2 SASI_Hs01_00151159 predicted 240
3 SASI_Hs01_00151160 predicted 324
4 SASI_Hs01_00151161 predicted 319
5 SASI_Hs01_00151162 predicted 216
6 SASI_Hs01_00151163 predicted 326
7 SASI_Hs01_00151164 predicted 336
8 SASI_Hs01_00151165 predicted 231
9 SASI_Hs01_00151166 predicted 240
10 SASI_Hs01_00151167 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212476 predicted 555
2 SASI_Rn02_00212477 predicted 532
3 SASI_Rn02_00212478 predicted 323
4 SASI_Rn02_00212479 predicted 444
5 SASI_Rn02_00212480 predicted 519
6 SASI_Rn02_00212481 predicted 361
7 SASI_Rn02_00212482 predicted 527
8 SASI_Rn02_00212483 predicted 355
9 SASI_Rn02_00212484 predicted 575
10 SASI_Rn02_00212485 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037584 predicted 535
2 SASI_Mm01_00037585 predicted 242
3 SASI_Mm01_00037586 predicted 227
4 SASI_Mm01_00037587 predicted 516
5 SASI_Mm01_00037588 predicted 536
6 SASI_Mm01_00037589 predicted 216
7 SASI_Mm01_00037590 predicted 374
8 SASI_Mm02_00329527 predicted 430
9 SASI_Mm01_00037591 predicted 202
10 SASI_Mm01_00037592 predicted 237
11 SASI_Mm01_00037593 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026035
VALIDATED
MRPL55 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L55
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026035.1-383s1c1
Sequence:CCGGCTCCACTATCCATATCCGATACTCGAGTATCGGATATGGATAGTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026035.1-619s1c1
Sequence:CCGGGTAAGGATGGAGGGCATCTATCTCGAGATAGATGCCCTCCATCCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026035.1-382s1c1
Sequence:CCGGGCTCCACTATCCATATCCGATCTCGAGATCGGATATGGATAGTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-538s21c1
Sequence:CCGGTTTGACACTGAACGATATAAACTCGAGTTTATATCGTTCAGTGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-243s21c1
Sequence:CCGGTGTGAGAGCAGCCTTACCTACCTCGAGGTAGGTAAGGCTGCTCTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-376s21c1
Sequence:CCGGGACGGCTCCACTATCCATATCCTCGAGGATATGGATAGTGGAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-351s21c1
Sequence:CCGGCTACCCTGTGCTCTTGGTCAACTCGAGTTGACCAAGAGCACAGGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-595s21c1
Sequence:CCGGGGAGTTCCACCAGGGACATTTCTCGAGAAATGTCCCTGGTGGAACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026035
VALIDATED
MRPL55 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L55
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026035.1-383s1c1
Sequence:CCGGCTCCACTATCCATATCCGATACTCGAGTATCGGATATGGATAGTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026035.1-619s1c1
Sequence:CCGGGTAAGGATGGAGGGCATCTATCTCGAGATAGATGCCCTCCATCCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026035.1-382s1c1
Sequence:CCGGGCTCCACTATCCATATCCGATCTCGAGATCGGATATGGATAGTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-538s21c1
Sequence:CCGGTTTGACACTGAACGATATAAACTCGAGTTTATATCGTTCAGTGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-243s21c1
Sequence:CCGGTGTGAGAGCAGCCTTACCTACCTCGAGGTAGGTAAGGCTGCTCTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-376s21c1
Sequence:CCGGGACGGCTCCACTATCCATATCCTCGAGGATATGGATAGTGGAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-351s21c1
Sequence:CCGGCTACCCTGTGCTCTTGGTCAACTCGAGTTGACCAAGAGCACAGGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-595s21c1
Sequence:CCGGGGAGTTCCACCAGGGACATTTCTCGAGAAATGTCCCTGGTGGAACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026035
VALIDATED
MRPL55 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L55
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026035.1-383s1c1
Sequence:CCGGCTCCACTATCCATATCCGATACTCGAGTATCGGATATGGATAGTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026035.1-619s1c1
Sequence:CCGGGTAAGGATGGAGGGCATCTATCTCGAGATAGATGCCCTCCATCCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026035.1-382s1c1
Sequence:CCGGGCTCCACTATCCATATCCGATCTCGAGATCGGATATGGATAGTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-538s21c1
Sequence:CCGGTTTGACACTGAACGATATAAACTCGAGTTTATATCGTTCAGTGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-243s21c1
Sequence:CCGGTGTGAGAGCAGCCTTACCTACCTCGAGGTAGGTAAGGCTGCTCTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-376s21c1
Sequence:CCGGGACGGCTCCACTATCCATATCCTCGAGGATATGGATAGTGGAGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-351s21c1
Sequence:CCGGCTACCCTGTGCTCTTGGTCAACTCGAGTTGACCAAGAGCACAGGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026035.2-595s21c1
Sequence:CCGGGGAGTTCCACCAGGGACATTTCTCGAGAAATGTCCCTGGTGGAACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181441
VALIDATED
MRPL55 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L55
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181441.2-357s21c1
Sequence:CCGGCCAGGCTTATGCACGACTCTACTCGAGTAGAGTCGTGCATAAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181441.2-442s21c1
Sequence:CCGGATGCTGGCGATGCCCATAGATCTCGAGATCTATGGGCATCGCCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181441.2-458s21c1
Sequence:CCGGTAGATCTGGACACCCTGTCTCCTCGAGGAGACAGGGTGTCCAGATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181441.2-536s21c1
Sequence:CCGGAGTACGAGCAGGAGCTCAGTGCTCGAGCACTGAGCTCCTGCTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181441.2-523s21c1
Sequence:CCGGCAGTCGAGGAAGGAGTACGAGCTCGAGCTCGTACTCCTTCCTCGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181441
VALIDATED
MRPL55 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L55
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181441.2-357s21c1
Sequence:CCGGCCAGGCTTATGCACGACTCTACTCGAGTAGAGTCGTGCATAAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181441.2-442s21c1
Sequence:CCGGATGCTGGCGATGCCCATAGATCTCGAGATCTATGGGCATCGCCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181441.2-458s21c1
Sequence:CCGGTAGATCTGGACACCCTGTCTCCTCGAGGAGACAGGGTGTCCAGATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181441.2-536s21c1
Sequence:CCGGAGTACGAGCAGGAGCTCAGTGCTCGAGCACTGAGCTCCTGCTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181441.2-523s21c1
Sequence:CCGGCAGTCGAGGAAGGAGTACGAGCTCGAGCTCGTACTCCTTCCTCGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181441
VALIDATED
MRPL55 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L55
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181441.2-357s21c1
Sequence:CCGGCCAGGCTTATGCACGACTCTACTCGAGTAGAGTCGTGCATAAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181441.2-442s21c1
Sequence:CCGGATGCTGGCGATGCCCATAGATCTCGAGATCTATGGGCATCGCCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181441.2-458s21c1
Sequence:CCGGTAGATCTGGACACCCTGTCTCCTCGAGGAGACAGGGTGTCCAGATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181441.2-536s21c1
Sequence:CCGGAGTACGAGCAGGAGCTCAGTGCTCGAGCACTGAGCTCCTGCTCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181441.2-523s21c1
Sequence:CCGGCAGTCGAGGAAGGAGTACGAGCTCGAGCTCGTACTCCTTCCTCGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)