EMAIL THIS PAGE TO A FRIEND

MRPL9

mitochondrial ribosomal protein L9

67 Gene Product Result for
Synonyms: L9mt
UniProtKB ID: Q9BYD2, B2RD99, Q5SZR2, Q9BSW8
Gene ID:
Human(65005) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found at 8q21.11. [provided by RefSeq, Jul 2008]
Mouse(78523) mitochondrial ribosomal protein L9
Rat(310653) mitochondrial ribosomal protein L9
Zebrafish(572170) mitochondrial ribosomal protein L9
fruit fly(41859) mitochondrial ribosomal protein L9
cow(505981) mitochondrial ribosomal protein L9
domestic cat(101080905) mitochondrial ribosomal protein L9
dog(609109) mitochondrial ribosomal protein L9
chicken(100858402) mitochondrial ribosomal protein L9
domestic guinea pig(100726072) mitochondrial ribosomal protein L9
naked mole-rat(101698508) mitochondrial ribosomal protein L9
sheep(101119267) mitochondrial ribosomal protein L9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031420 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031420 Rosetta Predictions human pricing
NM_001007696 Rosetta Predictions rat pricing
NM_030116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060394 predicted 1029
2 SASI_Hs01_00060395 predicted 779
3 SASI_Hs01_00060396 predicted 603
4 SASI_Hs01_00060397 predicted 406
5 SASI_Hs02_00358806 predicted 337
6 SASI_Hs01_00060398 predicted 434
7 SASI_Hs01_00060400 predicted 737
8 SASI_Hs01_00060401 predicted 968
9 SASI_Hs01_00060403 predicted 1020
10 SASI_Hs02_00358807 predicted 766
11 SASI_Hs01_00060399 predicted 209
12 SASI_Hs01_00060402 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080892 predicted 1029
2 SASI_Rn01_00080893 predicted 660
3 SASI_Rn02_00198853 predicted 888
4 SASI_Rn01_00080894 predicted 1126
5 SASI_Rn01_00080895 predicted 650
6 SASI_Rn01_00080896 predicted 859
7 SASI_Rn01_00080897 predicted 303
8 SASI_Rn01_00080898 predicted 1101
9 SASI_Rn02_00198854 predicted 358
10 SASI_Rn01_00080899 predicted 425
11 SASI_Rn01_00080900 predicted 929
12 SASI_Rn01_00080901 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184701 predicted 1079
2 SASI_Mm01_00184702 predicted 525
3 SASI_Mm02_00336511 predicted 999
4 SASI_Mm01_00184703 predicted 506
5 SASI_Mm01_00184704 predicted 385
6 SASI_Mm01_00184705 predicted 557
7 SASI_Mm01_00184707 predicted 546
8 SASI_Mm01_00184708 predicted 994
9 SASI_Mm01_00184709 predicted 328
10 SASI_Mm02_00336512 predicted 702
11 SASI_Mm01_00184706 predicted 662
12 SASI_Mm01_00184710 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030116
VALIDATED
MRPL9 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L9
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030116.2-136s21c1
Sequence:CCGGGACTTCAGTCTCTCTCATTATCTCGAGATAATGAGAGAGACTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030116.2-1134s21c1
Sequence:CCGGGCAGAAATGAAGAGCTGCTTACTCGAGTAAGCAGCTCTTCATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030116.2-351s1c1
Sequence:CCGGGAAATCTGTGGGTCGTAACAACTCGAGTTGTTACGACCCACAGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030116.2-301s21c1
Sequence:CCGGACGCAGTCTGTGGACGAAATTCTCGAGAATTTCGTCCACAGACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030116.2-1388s21c1
Sequence:CCGGGCTGGGATTAAAGATGCTTAACTCGAGTTAAGCATCTTTAATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030116.1-133s1c1
Sequence:CCGGCGTGACTTCAGTCTCTCTCATCTCGAGATGAGAGAGACTGAAGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-276s1c1
Sequence:CCGGCAAAGACAACTTGGAGCTCATCTCGAGATGAGCTCCAAGTTGTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030116.1-576s1c1
Sequence:CCGGCCGCCATTTCTTCAAGAATCTCTCGAGAGATTCTTGAAGAAATGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-1134s1c1
Sequence:CCGGGCAGAAATGAAGAGCTGCTTACTCGAGTAAGCAGCTCTTCATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-491s1c1
Sequence:CCGGCGACAGTGAAGTTTCTGAGAACTCGAGTTCTCAGAAACTTCACTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-1388s1c1
Sequence:CCGGGCTGGGATTAAAGATGCTTAACTCGAGTTAAGCATCTTTAATCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-540s1c1
Sequence:CCGGCAATGTCAAATGGGAACTAAACTCGAGTTTAGTTCCCATTTGACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030116
VALIDATED
MRPL9 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L9
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030116.2-136s21c1
Sequence:CCGGGACTTCAGTCTCTCTCATTATCTCGAGATAATGAGAGAGACTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030116.2-1134s21c1
Sequence:CCGGGCAGAAATGAAGAGCTGCTTACTCGAGTAAGCAGCTCTTCATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030116.2-351s1c1
Sequence:CCGGGAAATCTGTGGGTCGTAACAACTCGAGTTGTTACGACCCACAGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030116.2-301s21c1
Sequence:CCGGACGCAGTCTGTGGACGAAATTCTCGAGAATTTCGTCCACAGACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030116.2-1388s21c1
Sequence:CCGGGCTGGGATTAAAGATGCTTAACTCGAGTTAAGCATCTTTAATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030116.1-133s1c1
Sequence:CCGGCGTGACTTCAGTCTCTCTCATCTCGAGATGAGAGAGACTGAAGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-276s1c1
Sequence:CCGGCAAAGACAACTTGGAGCTCATCTCGAGATGAGCTCCAAGTTGTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030116.1-576s1c1
Sequence:CCGGCCGCCATTTCTTCAAGAATCTCTCGAGAGATTCTTGAAGAAATGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-1134s1c1
Sequence:CCGGGCAGAAATGAAGAGCTGCTTACTCGAGTAAGCAGCTCTTCATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-491s1c1
Sequence:CCGGCGACAGTGAAGTTTCTGAGAACTCGAGTTCTCAGAAACTTCACTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-1388s1c1
Sequence:CCGGGCTGGGATTAAAGATGCTTAACTCGAGTTAAGCATCTTTAATCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-540s1c1
Sequence:CCGGCAATGTCAAATGGGAACTAAACTCGAGTTTAGTTCCCATTTGACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030116
VALIDATED
MRPL9 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L9
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030116.2-136s21c1
Sequence:CCGGGACTTCAGTCTCTCTCATTATCTCGAGATAATGAGAGAGACTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030116.2-1134s21c1
Sequence:CCGGGCAGAAATGAAGAGCTGCTTACTCGAGTAAGCAGCTCTTCATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030116.2-351s1c1
Sequence:CCGGGAAATCTGTGGGTCGTAACAACTCGAGTTGTTACGACCCACAGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030116.2-301s21c1
Sequence:CCGGACGCAGTCTGTGGACGAAATTCTCGAGAATTTCGTCCACAGACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030116.2-1388s21c1
Sequence:CCGGGCTGGGATTAAAGATGCTTAACTCGAGTTAAGCATCTTTAATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030116.1-133s1c1
Sequence:CCGGCGTGACTTCAGTCTCTCTCATCTCGAGATGAGAGAGACTGAAGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-276s1c1
Sequence:CCGGCAAAGACAACTTGGAGCTCATCTCGAGATGAGCTCCAAGTTGTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030116.1-576s1c1
Sequence:CCGGCCGCCATTTCTTCAAGAATCTCTCGAGAGATTCTTGAAGAAATGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-1134s1c1
Sequence:CCGGGCAGAAATGAAGAGCTGCTTACTCGAGTAAGCAGCTCTTCATTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-491s1c1
Sequence:CCGGCGACAGTGAAGTTTCTGAGAACTCGAGTTCTCAGAAACTTCACTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-1388s1c1
Sequence:CCGGGCTGGGATTAAAGATGCTTAACTCGAGTTAAGCATCTTTAATCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030116.1-540s1c1
Sequence:CCGGCAATGTCAAATGGGAACTAAACTCGAGTTTAGTTCCCATTTGACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031420
MRPL9 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031420.2-1093s1c1
Sequence:CCGGCAGAAGTACCAGGCTGTAGATCTCGAGATCTACAGCCTGGTACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031420.2-939s1c1
Sequence:CCGGGAAATGTGCAAGCACCCTGATCTCGAGATCAGGGTGCTTGCACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031420.2-752s1c1
Sequence:CCGGGTGACGGTAAATGGGCTTGATCTCGAGATCAAGCCCATTTACCGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-512s1c1
Sequence:CCGGGAGAAATTGCTGAGACAAGAACTCGAGTTCTTGTCTCAGCAATTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-656s1c1
Sequence:CCGGCGCCACTTCTTTAAGAATCTTCTCGAGAAGATTCTTAAAGAAGTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-602s1c1
Sequence:CCGGGAGGTAGGGATGAAGAACAATCTCGAGATTGTTCTTCATCCCTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-566s1c1
Sequence:CCGGGAGGCGACAGTGAAATTTCTACTCGAGTAGAAATTTCACTGTCGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031420.2-427s1c1
Sequence:CCGGGAAGAAATCTTTAGGCCGGAACTCGAGTTCCGGCCTAAAGATTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031420.2-619s1c1
Sequence:CCGGCAATGTCAAATGGGAGCTGAACTCGAGTTCAGCTCCCATTTGACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031420
MRPL9 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031420.2-1093s1c1
Sequence:CCGGCAGAAGTACCAGGCTGTAGATCTCGAGATCTACAGCCTGGTACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031420.2-939s1c1
Sequence:CCGGGAAATGTGCAAGCACCCTGATCTCGAGATCAGGGTGCTTGCACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031420.2-752s1c1
Sequence:CCGGGTGACGGTAAATGGGCTTGATCTCGAGATCAAGCCCATTTACCGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-512s1c1
Sequence:CCGGGAGAAATTGCTGAGACAAGAACTCGAGTTCTTGTCTCAGCAATTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-656s1c1
Sequence:CCGGCGCCACTTCTTTAAGAATCTTCTCGAGAAGATTCTTAAAGAAGTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-602s1c1
Sequence:CCGGGAGGTAGGGATGAAGAACAATCTCGAGATTGTTCTTCATCCCTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-566s1c1
Sequence:CCGGGAGGCGACAGTGAAATTTCTACTCGAGTAGAAATTTCACTGTCGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031420.2-427s1c1
Sequence:CCGGGAAGAAATCTTTAGGCCGGAACTCGAGTTCCGGCCTAAAGATTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031420.2-619s1c1
Sequence:CCGGCAATGTCAAATGGGAGCTGAACTCGAGTTCAGCTCCCATTTGACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031420
MRPL9 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031420.2-1093s1c1
Sequence:CCGGCAGAAGTACCAGGCTGTAGATCTCGAGATCTACAGCCTGGTACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031420.2-939s1c1
Sequence:CCGGGAAATGTGCAAGCACCCTGATCTCGAGATCAGGGTGCTTGCACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031420.2-752s1c1
Sequence:CCGGGTGACGGTAAATGGGCTTGATCTCGAGATCAAGCCCATTTACCGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-512s1c1
Sequence:CCGGGAGAAATTGCTGAGACAAGAACTCGAGTTCTTGTCTCAGCAATTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-656s1c1
Sequence:CCGGCGCCACTTCTTTAAGAATCTTCTCGAGAAGATTCTTAAAGAAGTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-602s1c1
Sequence:CCGGGAGGTAGGGATGAAGAACAATCTCGAGATTGTTCTTCATCCCTACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031420.2-566s1c1
Sequence:CCGGGAGGCGACAGTGAAATTTCTACTCGAGTAGAAATTTCACTGTCGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031420.2-427s1c1
Sequence:CCGGGAAGAAATCTTTAGGCCGGAACTCGAGTTCCGGCCTAAAGATTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031420.2-619s1c1
Sequence:CCGGCAATGTCAAATGGGAGCTGAACTCGAGTTCAGCTCCCATTTGACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)