EMAIL THIS PAGE TO A FRIEND

MRPS10

mitochondrial ribosomal protein S10

126 Gene Product Result for
Synonyms: MRP-S10 PNAS-122
UniProtKB ID: P82664, B2RE89, Q9H3E5, Q9NVR3
Gene ID:
Human(55173) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S10P family. Pseudogenes corresponding to this gene are found on chromosomes 1q, 3p, and 9p. [provided by RefSeq, Jul 2008]
Mouse(64657) mitochondrial ribosomal protein S10
Rat(363187) mitochondrial ribosomal protein S10
Zebrafish(565937) mitochondrial ribosomal protein S10
fruit fly(41838) mitochondrial ribosomal protein S10
chicken(421385) mitochondrial ribosomal protein S10
cow(515885) mitochondrial ribosomal protein S10
domestic cat(101080888) mitochondrial ribosomal protein S10
dog(474902) mitochondrial ribosomal protein S10
Goat(100861002) mitochondrial ribosomal protein S10
sheep(101108866) mitochondrial ribosomal protein S10
naked mole-rat(101704899) mitochondrial ribosomal protein S10
domestic guinea pig(100714593) mitochondrial ribosomal protein S10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018141 Rosetta Predictions human pricing
NM_001008859 Rosetta Predictions rat pricing
XM_579252 Rosetta Predictions rat pricing
NM_183086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114836 predicted 390
2 SASI_Hs01_00114837 predicted 567
3 SASI_Hs01_00114838 predicted 302
4 SASI_Hs02_00351370 predicted 203
5 SASI_Hs01_00114839 predicted 340
6 SASI_Hs01_00114841 predicted 510
7 SASI_Hs02_00351371 predicted 299
8 SASI_Hs01_00114843 predicted 287
9 SASI_Hs01_00114844 predicted 697
10 SASI_Hs01_00114845 predicted 222
11 SASI_Hs01_00114840 predicted 430
12 SASI_Hs01_00114842 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087762 predicted 222
2 SASI_Rn01_00087763 predicted 216
3 SASI_Rn02_00199378 predicted 245
4 SASI_Rn02_00199379 predicted 248
5 SASI_Rn01_00087765 predicted 278
6 SASI_Rn01_00087766 predicted 201
7 SASI_Rn01_00087767 predicted 196
8 SASI_Rn01_00087768 predicted 199
9 SASI_Rn01_00087770 predicted 199
10 SASI_Rn01_00087771 predicted 194
11 SASI_Rn01_00087764 predicted 293
12 SASI_Rn01_00087769 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150089 predicted 224
2 SASI_Rn01_00150090 predicted 220
3 SASI_Rn01_00150091 predicted 295
4 SASI_Rn01_00150092 predicted 293
5 SASI_Rn01_00150093 predicted 206
6 SASI_Rn01_00150094 predicted 205
7 SASI_Rn01_00150095 predicted 209
8 SASI_Rn01_00150096 predicted 211
9 SASI_Rn01_00150097 predicted 203
10 SASI_Rn01_00150098 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165764 predicted 349
2 SASI_Mm02_00350064 predicted 342
3 SASI_Mm01_00165765 predicted 371
4 SASI_Mm01_00165766 predicted 520
5 SASI_Mm01_00165767 predicted 304
6 SASI_Mm01_00165769 predicted 855
7 SASI_Mm01_00165770 predicted 883
8 SASI_Mm01_00165771 predicted 327
9 SASI_Mm01_00165772 predicted 404
10 SASI_Mm01_00165773 predicted 630
11 SASI_Mm01_00165768 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018141
VALIDATED
MRPS10 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-83s1c1
Sequence:CCGGGTAAACACTTCTAAGGGCAATCTCGAGATTGCCCTTAGAAGTGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-169s1c1
Sequence:CCGGCGTTGATGTTCCAAAGGATTTCTCGAGAAATCCTTTGGAACATCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018141.2-558s1c1
Sequence:CCGGCAGAACACATCAAGGAGCCAACTCGAGTTGGCTCCTTGATGTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-197s1c1
Sequence:CCGGCCTGTGGTAACAATCTCTGATCTCGAGATCAGAGATTGTTACCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-374s1c1
Sequence:CCGGCTTCTCCAATCAGTGCATATTCTCGAGAATATGCACTGATTGGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-200s1c1
Sequence:CCGGGTGGTAACAATCTCTGATGAACTCGAGTTCATCAGAGATTGTTACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018141.2-136s1c1
Sequence:CCGGCAATATGAAGTGGGTACAGTTCTCGAGAACTGTACCCACTTCATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018141.2-1934s1c1
Sequence:CCGGGCACATCTTTGGAGTAGTTATCTCGAGATAACTACTCCAAAGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-473s1c1
Sequence:CCGGGCAGATGTCTACTTGGAATATCTCGAGATATTCCAAGTAGACATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018141
VALIDATED
MRPS10 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-83s1c1
Sequence:CCGGGTAAACACTTCTAAGGGCAATCTCGAGATTGCCCTTAGAAGTGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-169s1c1
Sequence:CCGGCGTTGATGTTCCAAAGGATTTCTCGAGAAATCCTTTGGAACATCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018141.2-558s1c1
Sequence:CCGGCAGAACACATCAAGGAGCCAACTCGAGTTGGCTCCTTGATGTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-197s1c1
Sequence:CCGGCCTGTGGTAACAATCTCTGATCTCGAGATCAGAGATTGTTACCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-374s1c1
Sequence:CCGGCTTCTCCAATCAGTGCATATTCTCGAGAATATGCACTGATTGGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-200s1c1
Sequence:CCGGGTGGTAACAATCTCTGATGAACTCGAGTTCATCAGAGATTGTTACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018141.2-136s1c1
Sequence:CCGGCAATATGAAGTGGGTACAGTTCTCGAGAACTGTACCCACTTCATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018141.2-1934s1c1
Sequence:CCGGGCACATCTTTGGAGTAGTTATCTCGAGATAACTACTCCAAAGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-473s1c1
Sequence:CCGGGCAGATGTCTACTTGGAATATCTCGAGATATTCCAAGTAGACATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018141
VALIDATED
MRPS10 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-83s1c1
Sequence:CCGGGTAAACACTTCTAAGGGCAATCTCGAGATTGCCCTTAGAAGTGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-169s1c1
Sequence:CCGGCGTTGATGTTCCAAAGGATTTCTCGAGAAATCCTTTGGAACATCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018141.2-558s1c1
Sequence:CCGGCAGAACACATCAAGGAGCCAACTCGAGTTGGCTCCTTGATGTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-197s1c1
Sequence:CCGGCCTGTGGTAACAATCTCTGATCTCGAGATCAGAGATTGTTACCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-374s1c1
Sequence:CCGGCTTCTCCAATCAGTGCATATTCTCGAGAATATGCACTGATTGGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-200s1c1
Sequence:CCGGGTGGTAACAATCTCTGATGAACTCGAGTTCATCAGAGATTGTTACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018141.2-136s1c1
Sequence:CCGGCAATATGAAGTGGGTACAGTTCTCGAGAACTGTACCCACTTCATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018141.2-1934s1c1
Sequence:CCGGGCACATCTTTGGAGTAGTTATCTCGAGATAACTACTCCAAAGATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018141.2-473s1c1
Sequence:CCGGGCAGATGTCTACTTGGAATATCTCGAGATATTCCAAGTAGACATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183086
VALIDATED
MRPS10 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183086.1-581s1c1
Sequence:CCGGCCTGGAGTATATCCAGCGAAACTCGAGTTTCGCTGGATATACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183086.2-457s21c1
Sequence:CCGGAGCGCTTCACTCTTCTCAAGTCTCGAGACTTGAGAAGAGTGAAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-857s1c1
Sequence:CCGGGCACCACTGTATGTTCTCTATCTCGAGATAGAGAACATACAGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-405s1c1
Sequence:CCGGGCTGCTAAAGAACTTGGCATTCTCGAGAATGCCAAGTTCTTTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-530s1c1
Sequence:CCGGCTACAGATGTTTGGAGTTAAACTCGAGTTTAACTCCAAACATCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-294s1c1
Sequence:CCGGCCTACGATAACCACTTCCGATCTCGAGATCGGAAGTGGTTATCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183086.2-882s21c1
Sequence:CCGGAGGATGCTTGTGTCCCGATATCTCGAGATATCGGGACACAAGCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183086.2-638s21c1
Sequence:CCGGGATACAGCAGTTGCCAGAACACTCGAGTGTTCTGGCAACTGCTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183086.2-494s21c1
Sequence:CCGGGAAACACAGAGTCCAGTATGACTCGAGTCATACTGGACTCTGTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183086
VALIDATED
MRPS10 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183086.1-581s1c1
Sequence:CCGGCCTGGAGTATATCCAGCGAAACTCGAGTTTCGCTGGATATACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183086.2-457s21c1
Sequence:CCGGAGCGCTTCACTCTTCTCAAGTCTCGAGACTTGAGAAGAGTGAAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-857s1c1
Sequence:CCGGGCACCACTGTATGTTCTCTATCTCGAGATAGAGAACATACAGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-405s1c1
Sequence:CCGGGCTGCTAAAGAACTTGGCATTCTCGAGAATGCCAAGTTCTTTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-530s1c1
Sequence:CCGGCTACAGATGTTTGGAGTTAAACTCGAGTTTAACTCCAAACATCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-294s1c1
Sequence:CCGGCCTACGATAACCACTTCCGATCTCGAGATCGGAAGTGGTTATCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183086.2-882s21c1
Sequence:CCGGAGGATGCTTGTGTCCCGATATCTCGAGATATCGGGACACAAGCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183086.2-638s21c1
Sequence:CCGGGATACAGCAGTTGCCAGAACACTCGAGTGTTCTGGCAACTGCTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183086.2-494s21c1
Sequence:CCGGGAAACACAGAGTCCAGTATGACTCGAGTCATACTGGACTCTGTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183086
VALIDATED
MRPS10 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183086.1-581s1c1
Sequence:CCGGCCTGGAGTATATCCAGCGAAACTCGAGTTTCGCTGGATATACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183086.2-457s21c1
Sequence:CCGGAGCGCTTCACTCTTCTCAAGTCTCGAGACTTGAGAAGAGTGAAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-857s1c1
Sequence:CCGGGCACCACTGTATGTTCTCTATCTCGAGATAGAGAACATACAGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-405s1c1
Sequence:CCGGGCTGCTAAAGAACTTGGCATTCTCGAGAATGCCAAGTTCTTTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-530s1c1
Sequence:CCGGCTACAGATGTTTGGAGTTAAACTCGAGTTTAACTCCAAACATCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183086.1-294s1c1
Sequence:CCGGCCTACGATAACCACTTCCGATCTCGAGATCGGAAGTGGTTATCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183086.2-882s21c1
Sequence:CCGGAGGATGCTTGTGTCCCGATATCTCGAGATATCGGGACACAAGCATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183086.2-638s21c1
Sequence:CCGGGATACAGCAGTTGCCAGAACACTCGAGTGTTCTGGCAACTGCTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183086.2-494s21c1
Sequence:CCGGGAAACACAGAGTCCAGTATGACTCGAGTCATACTGGACTCTGTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)