EMAIL THIS PAGE TO A FRIEND

MRPS11

mitochondrial ribosomal protein S11

65 Gene Product Result for
Synonyms: HCC-2
UniProtKB ID: P82912, B2RD52, Q969D7, Q96GI3, Q9BYC3
Gene ID:
Human(64963) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that contains a high level of sequence similarity with ribosomal protein S11P family members. A pseudogene corresponding to this gene is found on chromosome 20. Sequence analysis identified two transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2008]
Mouse(67994) mitochondrial ribosomal protein S11
Rat(499185) mitochondrial ribosomal protein S11
Zebrafish(556272) mitochondrial ribosomal protein S11
domestic cat(101085042) mitochondrial ribosomal protein S11
cow(509816) mitochondrial ribosomal protein S11
dog(488727) mitochondrial ribosomal protein S11
chicken(415498) mitochondrial ribosomal protein S11
fruit fly(42061) mitochondrial ribosomal protein S11
domestic guinea pig(100730942) mitochondrial ribosomal protein S11
naked mole-rat(101724791) mitochondrial ribosomal protein S11
sheep(101122631) mitochondrial ribosomal protein S11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022839 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022839 Rosetta Predictions human pricing
NM_176805 Rosetta Predictions human pricing
NM_001109148 Rosetta Predictions rat pricing
NM_026498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125644 predicted 888
2 SASI_Hs01_00125645 predicted 886
3 SASI_Hs02_00356154 predicted 855
4 SASI_Hs01_00125646 predicted 879
5 SASI_Hs01_00125647 predicted 832
6 SASI_Hs01_00125648 predicted 765
7 SASI_Hs01_00125649 predicted 849
8 SASI_Hs01_00125650 predicted 769
9 SASI_Hs01_00125651 predicted 774
10 SASI_Hs01_00125652 predicted 868
11 SASI_Hs01_00125653 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244304 predicted 787
2 SASI_Hs01_00244305 predicted 784
3 SASI_Hs02_00369217 predicted 756
4 SASI_Hs01_00244306 predicted 780
5 SASI_Hs01_00244307 predicted 739
6 SASI_Hs01_00244308 predicted 662
7 SASI_Hs01_00244309 predicted 756
8 SASI_Hs01_00244310 predicted 667
9 SASI_Hs01_00244311 predicted 674
10 SASI_Hs01_00244312 predicted 769
11 SASI_Hs01_00244313 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245600 predicted 551
2 SASI_Rn02_00245601 predicted 655
3 SASI_Rn02_00245602 predicted 316
4 SASI_Rn02_00245603 predicted 569
5 SASI_Rn02_00245604 predicted 494
6 SASI_Rn02_00245605 predicted 276
7 SASI_Rn02_00245606 predicted 402
8 SASI_Rn02_00245607 predicted 502
9 SASI_Rn02_00245608 predicted 331
10 SASI_Rn02_00245609 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046773 predicted 468
2 SASI_Mm01_00046774 predicted 646
3 SASI_Mm01_00046775 predicted 463
4 SASI_Mm02_00330388 predicted 719
5 SASI_Mm01_00046776 predicted 551
6 SASI_Mm01_00046777 predicted 609
7 SASI_Mm02_00330389 predicted 365
8 SASI_Mm01_00046779 predicted 398
9 SASI_Mm02_00330390 predicted 339
10 SASI_Mm01_00046780 predicted 397
11 SASI_Mm01_00046778 predicted 447
12 SASI_Mm01_00046781 predicted 662
13 SASI_Mm01_00046782 predicted 561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026498
MRPS11 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-480s21c1
Sequence:CCGGCATTAAAGCAACCTACAACAACTCGAGTTGTTGTAGGTTGCTTTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026498.2-841s21c1
Sequence:CCGGCTTGACTCCTGTGGATCCTACCTCGAGGTAGGATCCACAGGAGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-440s21c1
Sequence:CCGGAGTGGGCAGGGATGAAGTTTGCTCGAGCAAACTTCATCCCTGCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-174s1c1
Sequence:CCGGCCGAGATTAGAAGACTCAGCTCTCGAGAGCTGAGTCTTCTAATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-654s21c1
Sequence:CCGGCCACATCAGAGTCGTAGTGAACTCGAGTTCACTACGACTCTGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-337s21c1
Sequence:CCGGCCGAGATTAGAAGACTCAGCTCTCGAGAGCTGAGTCTTCTAATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-314s1c1
Sequence:CCGGACACATTAAAGCAACCTACAACTCGAGTTGTAGGTTGCTTTAATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-150s1c1
Sequence:CCGGGCTAAGAATATCCACACCGGACTCGAGTCCGGTGTGGATATTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-317s1c1
Sequence:CCGGCATTAAAGCAACCTACAACAACTCGAGTTGTTGTAGGTTGCTTTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-491s1c1
Sequence:CCGGCCACATCAGAGTCGTAGTGAACTCGAGTTCACTACGACTCTGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026498
MRPS11 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-480s21c1
Sequence:CCGGCATTAAAGCAACCTACAACAACTCGAGTTGTTGTAGGTTGCTTTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026498.2-841s21c1
Sequence:CCGGCTTGACTCCTGTGGATCCTACCTCGAGGTAGGATCCACAGGAGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-440s21c1
Sequence:CCGGAGTGGGCAGGGATGAAGTTTGCTCGAGCAAACTTCATCCCTGCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-174s1c1
Sequence:CCGGCCGAGATTAGAAGACTCAGCTCTCGAGAGCTGAGTCTTCTAATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-654s21c1
Sequence:CCGGCCACATCAGAGTCGTAGTGAACTCGAGTTCACTACGACTCTGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-337s21c1
Sequence:CCGGCCGAGATTAGAAGACTCAGCTCTCGAGAGCTGAGTCTTCTAATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-314s1c1
Sequence:CCGGACACATTAAAGCAACCTACAACTCGAGTTGTAGGTTGCTTTAATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-150s1c1
Sequence:CCGGGCTAAGAATATCCACACCGGACTCGAGTCCGGTGTGGATATTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-317s1c1
Sequence:CCGGCATTAAAGCAACCTACAACAACTCGAGTTGTTGTAGGTTGCTTTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-491s1c1
Sequence:CCGGCCACATCAGAGTCGTAGTGAACTCGAGTTCACTACGACTCTGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026498
MRPS11 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-480s21c1
Sequence:CCGGCATTAAAGCAACCTACAACAACTCGAGTTGTTGTAGGTTGCTTTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026498.2-841s21c1
Sequence:CCGGCTTGACTCCTGTGGATCCTACCTCGAGGTAGGATCCACAGGAGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-440s21c1
Sequence:CCGGAGTGGGCAGGGATGAAGTTTGCTCGAGCAAACTTCATCCCTGCCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-174s1c1
Sequence:CCGGCCGAGATTAGAAGACTCAGCTCTCGAGAGCTGAGTCTTCTAATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-654s21c1
Sequence:CCGGCCACATCAGAGTCGTAGTGAACTCGAGTTCACTACGACTCTGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026498.2-337s21c1
Sequence:CCGGCCGAGATTAGAAGACTCAGCTCTCGAGAGCTGAGTCTTCTAATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-314s1c1
Sequence:CCGGACACATTAAAGCAACCTACAACTCGAGTTGTAGGTTGCTTTAATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-150s1c1
Sequence:CCGGGCTAAGAATATCCACACCGGACTCGAGTCCGGTGTGGATATTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-317s1c1
Sequence:CCGGCATTAAAGCAACCTACAACAACTCGAGTTGTTGTAGGTTGCTTTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026498.1-491s1c1
Sequence:CCGGCCACATCAGAGTCGTAGTGAACTCGAGTTCACTACGACTCTGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022839
VALIDATED
MRPS11 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-771s21c1
Sequence:CCGGGCCTGGAAGTGATCTCAATCACTCGAGTGATTGAGATCACTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-556s1c1
Sequence:CCGGCCAGGTAGTCTCTGCTAGTAACTCGAGTTACTAGCAGAGACTACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-499s1c1
Sequence:CCGGGAAATTTGAGGAGATCCCAATCTCGAGATTGGGATCTCCTCAAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022839.2-891s21c1
Sequence:CCGGGCTCCAGTGGGACCTTGTAAACTCGAGTTTACAAGGTCCCACTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-556s21c1
Sequence:CCGGCCAGGTAGTCTCTGCTAGTAACTCGAGTTACTAGCAGAGACTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-694s21c1
Sequence:CCGGCGTGATCCACATCCGAGTTGTCTCGAGACAACTCGGATGTGGATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-509s21c1
Sequence:CCGGGAGATCCCAATTGCACACATTCTCGAGAATGTGTGCAATTGGGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-771s1c1
Sequence:CCGGGCCTGGAAGTGATCTCAATCACTCGAGTGATTGAGATCACTTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-509s1c1
Sequence:CCGGGAGATCCCAATTGCACACATTCTCGAGAATGTGTGCAATTGGGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-442s1c1
Sequence:CCGGGTTCAGCATTTACCCTCCCATCTCGAGATGGGAGGGTAAATGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022839
VALIDATED
MRPS11 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-771s21c1
Sequence:CCGGGCCTGGAAGTGATCTCAATCACTCGAGTGATTGAGATCACTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-556s1c1
Sequence:CCGGCCAGGTAGTCTCTGCTAGTAACTCGAGTTACTAGCAGAGACTACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-499s1c1
Sequence:CCGGGAAATTTGAGGAGATCCCAATCTCGAGATTGGGATCTCCTCAAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022839.2-891s21c1
Sequence:CCGGGCTCCAGTGGGACCTTGTAAACTCGAGTTTACAAGGTCCCACTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-556s21c1
Sequence:CCGGCCAGGTAGTCTCTGCTAGTAACTCGAGTTACTAGCAGAGACTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-694s21c1
Sequence:CCGGCGTGATCCACATCCGAGTTGTCTCGAGACAACTCGGATGTGGATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-509s21c1
Sequence:CCGGGAGATCCCAATTGCACACATTCTCGAGAATGTGTGCAATTGGGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-771s1c1
Sequence:CCGGGCCTGGAAGTGATCTCAATCACTCGAGTGATTGAGATCACTTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-509s1c1
Sequence:CCGGGAGATCCCAATTGCACACATTCTCGAGAATGTGTGCAATTGGGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-442s1c1
Sequence:CCGGGTTCAGCATTTACCCTCCCATCTCGAGATGGGAGGGTAAATGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022839
VALIDATED
MRPS11 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-771s21c1
Sequence:CCGGGCCTGGAAGTGATCTCAATCACTCGAGTGATTGAGATCACTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-556s1c1
Sequence:CCGGCCAGGTAGTCTCTGCTAGTAACTCGAGTTACTAGCAGAGACTACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-499s1c1
Sequence:CCGGGAAATTTGAGGAGATCCCAATCTCGAGATTGGGATCTCCTCAAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022839.2-891s21c1
Sequence:CCGGGCTCCAGTGGGACCTTGTAAACTCGAGTTTACAAGGTCCCACTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-556s21c1
Sequence:CCGGCCAGGTAGTCTCTGCTAGTAACTCGAGTTACTAGCAGAGACTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-694s21c1
Sequence:CCGGCGTGATCCACATCCGAGTTGTCTCGAGACAACTCGGATGTGGATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_022839.2-509s21c1
Sequence:CCGGGAGATCCCAATTGCACACATTCTCGAGAATGTGTGCAATTGGGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-771s1c1
Sequence:CCGGGCCTGGAAGTGATCTCAATCACTCGAGTGATTGAGATCACTTCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-509s1c1
Sequence:CCGGGAGATCCCAATTGCACACATTCTCGAGAATGTGTGCAATTGGGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022839.2-442s1c1
Sequence:CCGGGTTCAGCATTTACCCTCCCATCTCGAGATGGGAGGGTAAATGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)