EMAIL THIS PAGE TO A FRIEND

MRPS12

mitochondrial ribosomal protein S12

77 Gene Product Result for
Synonyms: MPR-S12 MT-RPS12 RPMS12 RPS12 RPSM12
UniProtKB ID: O15235, Q53X98
Gene ID:
Human(6183) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S12P family. The encoded protein is a key component of the ribosomal small subunit and controls the decoding fidelity and susceptibility to aminoglycoside antibiotics. The gene for mitochondrial seryl-tRNA synthetase is located upstream and adjacent to this gene, and both genes are possible candidates for the autosomal dominant deafness gene (DFNA4). Splice variants that differ in the 5' UTR have been found for this gene; all three variants encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(24030) mitochondrial ribosomal protein S12
Rat(292758) mitochondrial ribosomal protein S12
chicken(770472) mitochondrial ribosomal protein S12
domestic cat(101098759) mitochondrial ribosomal protein S12
cow(768042) mitochondrial ribosomal protein S12
dog(484517) mitochondrial ribosomal protein S12
sheep(101113694) mitochondrial ribosomal protein S12
naked mole-rat(101718054) mitochondrial ribosomal protein S12
domestic guinea pig(100735083) mitochondrial ribosomal protein S12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021107 Rosetta Predictions human pricing
NM_033362 Rosetta Predictions human pricing
NM_033363 Rosetta Predictions human pricing
NM_001106239 Rosetta Predictions rat pricing
NM_011885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169153 predicted 532
2 SASI_Hs01_00169154 predicted 597
3 SASI_Hs02_00354598 predicted 683
4 SASI_Hs01_00169155 predicted 549
5 SASI_Hs01_00169161 predicted 708
6 SASI_Hs01_00169156 predicted 600
7 SASI_Hs02_00354599 predicted 730
8 SASI_Hs01_00169162 predicted 702
9 SASI_Hs02_00354600 predicted 695
10 SASI_Hs02_00354601 predicted 640
11 SASI_Hs01_00169157 predicted 530
12 SASI_Hs01_00169158 predicted 558
13 SASI_Hs01_00169159 predicted 545
14 SASI_Hs01_00169160 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155930 predicted 499
2 SASI_Hs01_00155931 predicted 573
3 SASI_Hs02_00361211 predicted 653
4 SASI_Hs01_00155932 predicted 521
5 SASI_Hs01_00155938 predicted 675
6 SASI_Hs01_00155933 predicted 564
7 SASI_Hs02_00361212 predicted 696
8 SASI_Hs01_00155939 predicted 679
9 SASI_Hs02_00361213 predicted 660
10 SASI_Hs02_00361214 predicted 614
11 SASI_Hs01_00155934 predicted 508
12 SASI_Hs01_00155935 predicted 522
13 SASI_Hs01_00155936 predicted 516
14 SASI_Hs01_00155937 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067305 predicted 430
2 SASI_Hs01_00067306 predicted 498
3 SASI_Hs02_00361215 predicted 574
4 SASI_Hs01_00067307 predicted 453
5 SASI_Hs01_00067313 predicted 605
6 SASI_Hs01_00067308 predicted 499
7 SASI_Hs02_00361216 predicted 628
8 SASI_Hs01_00067314 predicted 600
9 SASI_Hs02_00361217 predicted 590
10 SASI_Hs02_00361218 predicted 540
11 SASI_Hs01_00067309 predicted 428
12 SASI_Hs01_00067310 predicted 455
13 SASI_Hs01_00067311 predicted 442
14 SASI_Hs01_00067312 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217008 predicted 221
2 SASI_Rn02_00217009 predicted 483
3 SASI_Rn02_00217010 predicted 226
4 SASI_Rn02_00217011 predicted 448
5 SASI_Rn02_00217012 predicted 267
6 SASI_Rn02_00217013 predicted 488
7 SASI_Rn02_00217014 predicted 226
8 SASI_Rn02_00217015 predicted 456
9 SASI_Rn02_00217016 predicted 474
10 SASI_Rn02_00217017 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081035 predicted 206
2 SASI_Mm01_00081036 predicted 252
3 SASI_Mm01_00081037 predicted 277
4 SASI_Mm01_00081038 predicted 216
5 SASI_Mm01_00081039 predicted 252
6 SASI_Mm01_00081040 predicted 447
7 SASI_Mm01_00081041 predicted 284
8 SASI_Mm01_00081042 predicted 291
9 SASI_Mm01_00081043 predicted 276
10 SASI_Mm01_00081044 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021107
VALIDATED
MRPS12 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-891s1c1
Sequence:CCGGCTCTTCCATCAGGACCACTATCTCGAGATAGTGGTCCTGATGGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-696s1c1
Sequence:CCGGCCAGGCGTCAAGCTCACCGTTCTCGAGAACGGTGAGCTTGACGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-380s1c1
Sequence:CCGGCCTAACTTGTGGCCCAGCTCTCTCGAGAGAGCTGGGCCACAAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-527s1c1
Sequence:CCGGCCTGTGCACGTTTACCCGCAACTCGAGTTGCGGGTAAACGTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-557s1c1
Sequence:CCGGGCCCAACTCAGCCAATCGCAACTCGAGTTGCGATTGGCTGAGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021107
VALIDATED
MRPS12 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-891s1c1
Sequence:CCGGCTCTTCCATCAGGACCACTATCTCGAGATAGTGGTCCTGATGGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-696s1c1
Sequence:CCGGCCAGGCGTCAAGCTCACCGTTCTCGAGAACGGTGAGCTTGACGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-380s1c1
Sequence:CCGGCCTAACTTGTGGCCCAGCTCTCTCGAGAGAGCTGGGCCACAAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-527s1c1
Sequence:CCGGCCTGTGCACGTTTACCCGCAACTCGAGTTGCGGGTAAACGTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-557s1c1
Sequence:CCGGGCCCAACTCAGCCAATCGCAACTCGAGTTGCGATTGGCTGAGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021107
VALIDATED
MRPS12 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-891s1c1
Sequence:CCGGCTCTTCCATCAGGACCACTATCTCGAGATAGTGGTCCTGATGGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-696s1c1
Sequence:CCGGCCAGGCGTCAAGCTCACCGTTCTCGAGAACGGTGAGCTTGACGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-380s1c1
Sequence:CCGGCCTAACTTGTGGCCCAGCTCTCTCGAGAGAGCTGGGCCACAAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-527s1c1
Sequence:CCGGCCTGTGCACGTTTACCCGCAACTCGAGTTGCGGGTAAACGTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021107.1-557s1c1
Sequence:CCGGGCCCAACTCAGCCAATCGCAACTCGAGTTGCGATTGGCTGAGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011885
VALIDATED
MRPS12 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011885.2-610s1c1
Sequence:CCGGGCAGGAATACTGAAGGTGAATCTCGAGATTCACCTTCAGTATTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-168s1c1
Sequence:CCGGCCTGAACCAGATGCACCGCTTCTCGAGAAGCGGTGCATCTGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-153s1c1
Sequence:CCGGCCGTTCCATGGCCACCCTGAACTCGAGTTCAGGGTGGCCATGGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-264s1c1
Sequence:CCGGCACATTCATCCGAAAGCCGAACTCGAGTTCGGCTTTCGGATGAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-258s1c1
Sequence:CCGGGTTGCGCACATTCATCCGAAACTCGAGTTTCGGATGAATGTGCGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011885
VALIDATED
MRPS12 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011885.2-610s1c1
Sequence:CCGGGCAGGAATACTGAAGGTGAATCTCGAGATTCACCTTCAGTATTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-168s1c1
Sequence:CCGGCCTGAACCAGATGCACCGCTTCTCGAGAAGCGGTGCATCTGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-153s1c1
Sequence:CCGGCCGTTCCATGGCCACCCTGAACTCGAGTTCAGGGTGGCCATGGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-264s1c1
Sequence:CCGGCACATTCATCCGAAAGCCGAACTCGAGTTCGGCTTTCGGATGAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-258s1c1
Sequence:CCGGGTTGCGCACATTCATCCGAAACTCGAGTTTCGGATGAATGTGCGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011885
VALIDATED
MRPS12 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011885.2-610s1c1
Sequence:CCGGGCAGGAATACTGAAGGTGAATCTCGAGATTCACCTTCAGTATTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-168s1c1
Sequence:CCGGCCTGAACCAGATGCACCGCTTCTCGAGAAGCGGTGCATCTGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-153s1c1
Sequence:CCGGCCGTTCCATGGCCACCCTGAACTCGAGTTCAGGGTGGCCATGGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-264s1c1
Sequence:CCGGCACATTCATCCGAAAGCCGAACTCGAGTTCGGCTTTCGGATGAATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011885.2-258s1c1
Sequence:CCGGGTTGCGCACATTCATCCGAAACTCGAGTTTCGGATGAATGTGCGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)