EMAIL THIS PAGE TO A FRIEND

MRPS14

mitochondrial ribosomal protein S14

46 Gene Product Result for
Synonyms: DJ262D12.2 HSMRPS14 MRP-S14 S14mt
UniProtKB ID: O60783, Q5R358
Gene ID:
Human(63931) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S14P family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Mouse(64659) mitochondrial ribosomal protein S14
Rat(289143) mitochondrial ribosomal protein S14
domestic guinea pig(100716472) mitochondrial ribosomal protein S14
naked mole-rat(101718927) mitochondrial ribosomal protein S14
sheep(101116494) mitochondrial ribosomal protein S14
Zebrafish(751639) mitochondrial ribosomal protein S14
cow(445421) mitochondrial ribosomal protein S14
domestic cat(101096128) mitochondrial ribosomal protein S14
dog(480061) mitochondrial ribosomal protein S14
chicken(424436) mitochondrial ribosomal protein S14
fruit fly(117414) mitochondrial ribosomal protein S14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051087 Anti-MRPS14 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022100 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022100 Rosetta Predictions human pricing
NM_001105963 Rosetta Predictions rat pricing
NM_025474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143644 predicted 777
2 SASI_Hs01_00143645 predicted 791
3 SASI_Hs01_00143646 predicted 768
4 SASI_Hs01_00143647 predicted 741
5 SASI_Hs01_00143648 predicted 849
6 SASI_Hs01_00143649 predicted 747
7 SASI_Hs01_00143650 predicted 763
8 SASI_Hs01_00143651 predicted 746
9 SASI_Hs01_00143652 predicted 839
10 SASI_Hs01_00143653 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214272 predicted 600
2 SASI_Rn02_00214273 predicted 812
3 SASI_Rn02_00214274 predicted 327
4 SASI_Rn02_00214275 predicted 705
5 SASI_Rn02_00214276 predicted 724
6 SASI_Rn02_00214277 predicted 355
7 SASI_Rn02_00214278 predicted 499
8 SASI_Rn02_00214279 predicted 455
9 SASI_Rn02_00214280 predicted 480
10 SASI_Rn02_00214281 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186825 predicted 436
2 SASI_Mm01_00186827 predicted 841
3 SASI_Mm02_00328335 predicted 614
4 SASI_Mm01_00186828 predicted 465
5 SASI_Mm01_00186829 predicted 449
6 SASI_Mm01_00186830 predicted 483
7 SASI_Mm01_00186831 predicted 600
8 SASI_Mm01_00186832 predicted 524
9 SASI_Mm01_00186833 predicted 209
10 SASI_Mm01_00186834 predicted 441
11 SASI_Mm01_00186826 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022100
VALIDATED
MRPS14 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022100.1-794s1c1
Sequence:CCGGGCAGTTTGTAATCCTGGACTACTCGAGTAGTCCAGGATTACAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-339s1c1
Sequence:CCGGCGTATAGTCTTCCGTCACTTACTCGAGTAAGTGACGGAAGACTATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-48s1c1
Sequence:CCGGCGGACGTTCAAGCAGATGGTTCTCGAGAACCATCTGCTTGAACGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-122s1c1
Sequence:CCGGGCGCGATGTGAAGAGACGAAACTCGAGTTTCGTCTCTTCACATCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-273s1c1
Sequence:CCGGAGAATCAGAAATCGGTGTGTTCTCGAGAACACACCGATTTCTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-162s21c1
Sequence:CCGGGATGAGAGGCTACGTATTAATCTCGAGATTAATACGTAGCCTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-184s21c1
Sequence:CCGGCACTCAGGAAGAATACCATTTCTCGAGAAATGGTATTCTTCCTGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-386s21c1
Sequence:CCGGCCAGCGAGCGACATGGTAAATCTCGAGATTTACCATGTCGCTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022100.1-631s21c1
Sequence:CCGGAGTACAAAGAGTAGCATAATACTCGAGTATTATGCTACTCTTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-339s21c1
Sequence:CCGGCGTATAGTCTTCCGTCACTTACTCGAGTAAGTGACGGAAGACTATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022100
VALIDATED
MRPS14 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022100.1-794s1c1
Sequence:CCGGGCAGTTTGTAATCCTGGACTACTCGAGTAGTCCAGGATTACAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-339s1c1
Sequence:CCGGCGTATAGTCTTCCGTCACTTACTCGAGTAAGTGACGGAAGACTATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-48s1c1
Sequence:CCGGCGGACGTTCAAGCAGATGGTTCTCGAGAACCATCTGCTTGAACGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-122s1c1
Sequence:CCGGGCGCGATGTGAAGAGACGAAACTCGAGTTTCGTCTCTTCACATCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-273s1c1
Sequence:CCGGAGAATCAGAAATCGGTGTGTTCTCGAGAACACACCGATTTCTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-162s21c1
Sequence:CCGGGATGAGAGGCTACGTATTAATCTCGAGATTAATACGTAGCCTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-184s21c1
Sequence:CCGGCACTCAGGAAGAATACCATTTCTCGAGAAATGGTATTCTTCCTGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-386s21c1
Sequence:CCGGCCAGCGAGCGACATGGTAAATCTCGAGATTTACCATGTCGCTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022100.1-631s21c1
Sequence:CCGGAGTACAAAGAGTAGCATAATACTCGAGTATTATGCTACTCTTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-339s21c1
Sequence:CCGGCGTATAGTCTTCCGTCACTTACTCGAGTAAGTGACGGAAGACTATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022100
VALIDATED
MRPS14 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022100.1-794s1c1
Sequence:CCGGGCAGTTTGTAATCCTGGACTACTCGAGTAGTCCAGGATTACAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-339s1c1
Sequence:CCGGCGTATAGTCTTCCGTCACTTACTCGAGTAAGTGACGGAAGACTATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-48s1c1
Sequence:CCGGCGGACGTTCAAGCAGATGGTTCTCGAGAACCATCTGCTTGAACGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-122s1c1
Sequence:CCGGGCGCGATGTGAAGAGACGAAACTCGAGTTTCGTCTCTTCACATCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_022100.1-273s1c1
Sequence:CCGGAGAATCAGAAATCGGTGTGTTCTCGAGAACACACCGATTTCTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-162s21c1
Sequence:CCGGGATGAGAGGCTACGTATTAATCTCGAGATTAATACGTAGCCTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-184s21c1
Sequence:CCGGCACTCAGGAAGAATACCATTTCTCGAGAAATGGTATTCTTCCTGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-386s21c1
Sequence:CCGGCCAGCGAGCGACATGGTAAATCTCGAGATTTACCATGTCGCTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022100.1-631s21c1
Sequence:CCGGAGTACAAAGAGTAGCATAATACTCGAGTATTATGCTACTCTTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022100.1-339s21c1
Sequence:CCGGCGTATAGTCTTCCGTCACTTACTCGAGTAAGTGACGGAAGACTATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025474
VALIDATED
MRPS14 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S14
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-174s21c1
Sequence:CCGGCGCTCAGAAAGAATACCATTTCTCGAGAAATGGTATTCTTTCTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-252s1c1
Sequence:CCGGGCTGTCCTGTTAGAATCAGAACTCGAGTTCTGATTCTAACAGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-87s1c1
Sequence:CCGGGTTACTATGTAGACTGGAGAACTCGAGTTCTCCAGTCTACATAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-174s1c1
Sequence:CCGGCGCTCAGAAAGAATACCATTTCTCGAGAAATGGTATTCTTTCTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-113s1c1
Sequence:CCGGCGTGATTTGAAGAGACGGAAACTCGAGTTTCCGTCTCTTCAAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025474.2-1403s1c1
Sequence:CCGGGCCAGTATAGTTCCTGATTAACTCGAGTTAATCAGGAACTATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-87s21c1
Sequence:CCGGGTTACTATGTAGACTGGAGAACTCGAGTTCTCCAGTCTACATAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-113s21c1
Sequence:CCGGCGTGATTTGAAGAGACGGAAACTCGAGTTTCCGTCTCTTCAAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-252s21c1
Sequence:CCGGGCTGTCCTGTTAGAATCAGAACTCGAGTTCTGATTCTAACAGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025474
VALIDATED
MRPS14 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S14
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-174s21c1
Sequence:CCGGCGCTCAGAAAGAATACCATTTCTCGAGAAATGGTATTCTTTCTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-252s1c1
Sequence:CCGGGCTGTCCTGTTAGAATCAGAACTCGAGTTCTGATTCTAACAGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-87s1c1
Sequence:CCGGGTTACTATGTAGACTGGAGAACTCGAGTTCTCCAGTCTACATAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-174s1c1
Sequence:CCGGCGCTCAGAAAGAATACCATTTCTCGAGAAATGGTATTCTTTCTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-113s1c1
Sequence:CCGGCGTGATTTGAAGAGACGGAAACTCGAGTTTCCGTCTCTTCAAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025474.2-1403s1c1
Sequence:CCGGGCCAGTATAGTTCCTGATTAACTCGAGTTAATCAGGAACTATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-87s21c1
Sequence:CCGGGTTACTATGTAGACTGGAGAACTCGAGTTCTCCAGTCTACATAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-113s21c1
Sequence:CCGGCGTGATTTGAAGAGACGGAAACTCGAGTTTCCGTCTCTTCAAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-252s21c1
Sequence:CCGGGCTGTCCTGTTAGAATCAGAACTCGAGTTCTGATTCTAACAGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025474
VALIDATED
MRPS14 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S14
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-174s21c1
Sequence:CCGGCGCTCAGAAAGAATACCATTTCTCGAGAAATGGTATTCTTTCTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-252s1c1
Sequence:CCGGGCTGTCCTGTTAGAATCAGAACTCGAGTTCTGATTCTAACAGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-87s1c1
Sequence:CCGGGTTACTATGTAGACTGGAGAACTCGAGTTCTCCAGTCTACATAGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-174s1c1
Sequence:CCGGCGCTCAGAAAGAATACCATTTCTCGAGAAATGGTATTCTTTCTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025474.2-113s1c1
Sequence:CCGGCGTGATTTGAAGAGACGGAAACTCGAGTTTCCGTCTCTTCAAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025474.2-1403s1c1
Sequence:CCGGGCCAGTATAGTTCCTGATTAACTCGAGTTAATCAGGAACTATACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-87s21c1
Sequence:CCGGGTTACTATGTAGACTGGAGAACTCGAGTTCTCCAGTCTACATAGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-113s21c1
Sequence:CCGGCGTGATTTGAAGAGACGGAAACTCGAGTTTCCGTCTCTTCAAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025474.3-252s21c1
Sequence:CCGGGCTGTCCTGTTAGAATCAGAACTCGAGTTCTGATTCTAACAGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)