EMAIL THIS PAGE TO A FRIEND

MRPS15

mitochondrial ribosomal protein S15

60 Gene Product Result for
Synonyms: MPR-S15 RPMS15 S15mt
UniProtKB ID: P82914, B2RD82, Q9H2K1
Gene ID:
Human(64960) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S15P family. The encoded protein is more than two times the size of its E. coli counterpart, with the 12S rRNA binding sites conserved. Between human and mouse, the encoded protein is the least conserved among small subunit ribosomal proteins. Pseudogenes corresponding to this gene are found on chromosomes 15q and 19q. [provided by RefSeq, Jul 2008]
Mouse(66407) mitochondrial ribosomal protein S15
Rat(298517) mitochondrial ribosomal protein S15
Zebrafish(436758) mitochondrial ribosomal protein S15
cow(508928) mitochondrial ribosomal protein S15
domestic cat(101089535) mitochondrial ribosomal protein S15
dog(475333) mitochondrial ribosomal protein S15
chicken(770261) mitochondrial ribosomal protein S15
sheep(101113805) mitochondrial ribosomal protein S15
naked mole-rat(101725042) mitochondrial ribosomal protein S15
domestic guinea pig(100719880) mitochondrial ribosomal protein S15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031280 Rosetta Predictions human pricing
NM_001007653 Rosetta Predictions rat pricing
NM_025544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225234 predicted 677
2 SASI_Hs01_00225235 predicted 553
3 SASI_Hs01_00225236 predicted 614
4 SASI_Hs01_00225237 predicted 545
5 SASI_Hs02_00358697 predicted 453
6 SASI_Hs01_00225241 predicted 528
7 SASI_Hs02_00358698 predicted 370
8 SASI_Hs01_00225243 predicted 584
9 SASI_Hs02_00358699 predicted 612
10 SASI_Hs02_00358700 predicted 365
11 SASI_Hs01_00225238 predicted 412
12 SASI_Hs01_00225239 predicted 316
13 SASI_Hs01_00225240 predicted 350
14 SASI_Hs01_00225242 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055229 predicted 1082
2 SASI_Rn01_00055230 predicted 1097
3 SASI_Rn01_00055231 predicted 455
4 SASI_Rn01_00055232 predicted 472
5 SASI_Rn02_00198775 predicted 1118
6 SASI_Rn01_00055233 predicted 989
7 SASI_Rn01_00055234 predicted 1155
8 SASI_Rn01_00055238 predicted 1168
9 SASI_Rn02_00198776 predicted 256
10 SASI_Rn02_00198777 predicted 542
11 SASI_Rn01_00055235 predicted 1032
12 SASI_Rn01_00055236 predicted 1063
13 SASI_Rn01_00055237 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141495 predicted 380
2 SASI_Mm01_00141496 predicted 511
3 SASI_Mm01_00141497 predicted 505
4 SASI_Mm01_00141498 predicted 568
5 SASI_Mm02_00328482 predicted 500
6 SASI_Mm01_00141499 predicted 390
7 SASI_Mm01_00141501 predicted 552
8 SASI_Mm01_00141502 predicted 330
9 SASI_Mm01_00141503 predicted 508
10 SASI_Mm02_00328483 predicted 600
11 SASI_Mm01_00141494 predicted 542
12 SASI_Mm01_00141500 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025544
VALIDATED
MRPS15 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S15
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-511s21c1
Sequence:CCGGCAGAACCTTGGAAGCTCAAATCTCGAGATTTGAGCTTCCAAGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-542s21c1
Sequence:CCGGACTGTCAGGATCCGCAATTATCTCGAGATAATTGCGGATCCTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-585s21c1
Sequence:CCGGGAAAGGACAAAGCCCACAAACCTCGAGGTTTGTGGGCTTTGTCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-766s21c1
Sequence:CCGGGGCTCTGTGCATTCGGGTTTACTCGAGTAAACCCGAATGCACAGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-653s21c1
Sequence:CCGGCTCCGTCAGACCAACTATGATCTCGAGATCATAGTTGGTCTGACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025544.1-495s1c1
Sequence:CCGGCATTGCCTTGACTGTCAGGATCTCGAGATCCTGACAGTCAAGGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025544.1-487s1c1
Sequence:CCGGGCTCAAATCATTGCCTTGACTCTCGAGAGTCAAGGCAATGATTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025544.1-311s1c1
Sequence:CCGGCCTCTGCGTTCATCAAAGAATCTCGAGATTCTTTGATGAACGCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025544
VALIDATED
MRPS15 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S15
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-511s21c1
Sequence:CCGGCAGAACCTTGGAAGCTCAAATCTCGAGATTTGAGCTTCCAAGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-542s21c1
Sequence:CCGGACTGTCAGGATCCGCAATTATCTCGAGATAATTGCGGATCCTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-585s21c1
Sequence:CCGGGAAAGGACAAAGCCCACAAACCTCGAGGTTTGTGGGCTTTGTCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-766s21c1
Sequence:CCGGGGCTCTGTGCATTCGGGTTTACTCGAGTAAACCCGAATGCACAGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-653s21c1
Sequence:CCGGCTCCGTCAGACCAACTATGATCTCGAGATCATAGTTGGTCTGACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025544.1-495s1c1
Sequence:CCGGCATTGCCTTGACTGTCAGGATCTCGAGATCCTGACAGTCAAGGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025544.1-487s1c1
Sequence:CCGGGCTCAAATCATTGCCTTGACTCTCGAGAGTCAAGGCAATGATTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025544.1-311s1c1
Sequence:CCGGCCTCTGCGTTCATCAAAGAATCTCGAGATTCTTTGATGAACGCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025544
VALIDATED
MRPS15 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S15
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-511s21c1
Sequence:CCGGCAGAACCTTGGAAGCTCAAATCTCGAGATTTGAGCTTCCAAGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-542s21c1
Sequence:CCGGACTGTCAGGATCCGCAATTATCTCGAGATAATTGCGGATCCTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-585s21c1
Sequence:CCGGGAAAGGACAAAGCCCACAAACCTCGAGGTTTGTGGGCTTTGTCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-766s21c1
Sequence:CCGGGGCTCTGTGCATTCGGGTTTACTCGAGTAAACCCGAATGCACAGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025544.2-653s21c1
Sequence:CCGGCTCCGTCAGACCAACTATGATCTCGAGATCATAGTTGGTCTGACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025544.1-495s1c1
Sequence:CCGGCATTGCCTTGACTGTCAGGATCTCGAGATCCTGACAGTCAAGGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025544.1-487s1c1
Sequence:CCGGGCTCAAATCATTGCCTTGACTCTCGAGAGTCAAGGCAATGATTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025544.1-311s1c1
Sequence:CCGGCCTCTGCGTTCATCAAAGAATCTCGAGATTCTTTGATGAACGCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031280
VALIDATED
MRPS15 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031280.2-489s1c1
Sequence:CCGGGTCTGTCAAGATCCGCAGTTACTCGAGTAACTGCGGATCTTGACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031280.2-385s1c1
Sequence:CCGGGCCAACAAGAAGGAGATGCTACTCGAGTAGCATCTCCTTCTTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-472s1c1
Sequence:CCGGGCTCGAATTATTGCCTTGTCTCTCGAGAGACAAGGCAATAATTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031280.2-501s1c1
Sequence:CCGGCCGCAGTTATGAAGAACACTTCTCGAGAAGTGTTCTTCATAACTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_031280.2-185s1c1
Sequence:CCGGCCAAGTTTCCTTTCAACCAGTCTCGAGACTGGTTGAAAGGAAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-523s1c1
Sequence:CCGGGAGAAACATCGAAAGGACAAACTCGAGTTTGTCCTTTCGATGTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-387s1c1
Sequence:CCGGCAACAAGAAGGAGATGCTAAACTCGAGTTTAGCATCTCCTTCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-553s1c1
Sequence:CCGGCGCTATCTGCTAATGAGCATTCTCGAGAATGCTCATTAGCAGATAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_031280.2-331s1c1
Sequence:CCGGCCTGGAATTGAGAAGGTTGATCTCGAGATCAACCTTCTCAATTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031280
VALIDATED
MRPS15 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031280.2-489s1c1
Sequence:CCGGGTCTGTCAAGATCCGCAGTTACTCGAGTAACTGCGGATCTTGACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031280.2-385s1c1
Sequence:CCGGGCCAACAAGAAGGAGATGCTACTCGAGTAGCATCTCCTTCTTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-472s1c1
Sequence:CCGGGCTCGAATTATTGCCTTGTCTCTCGAGAGACAAGGCAATAATTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031280.2-501s1c1
Sequence:CCGGCCGCAGTTATGAAGAACACTTCTCGAGAAGTGTTCTTCATAACTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_031280.2-185s1c1
Sequence:CCGGCCAAGTTTCCTTTCAACCAGTCTCGAGACTGGTTGAAAGGAAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-523s1c1
Sequence:CCGGGAGAAACATCGAAAGGACAAACTCGAGTTTGTCCTTTCGATGTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-387s1c1
Sequence:CCGGCAACAAGAAGGAGATGCTAAACTCGAGTTTAGCATCTCCTTCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-553s1c1
Sequence:CCGGCGCTATCTGCTAATGAGCATTCTCGAGAATGCTCATTAGCAGATAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_031280.2-331s1c1
Sequence:CCGGCCTGGAATTGAGAAGGTTGATCTCGAGATCAACCTTCTCAATTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031280
VALIDATED
MRPS15 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031280.2-489s1c1
Sequence:CCGGGTCTGTCAAGATCCGCAGTTACTCGAGTAACTGCGGATCTTGACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031280.2-385s1c1
Sequence:CCGGGCCAACAAGAAGGAGATGCTACTCGAGTAGCATCTCCTTCTTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-472s1c1
Sequence:CCGGGCTCGAATTATTGCCTTGTCTCTCGAGAGACAAGGCAATAATTCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031280.2-501s1c1
Sequence:CCGGCCGCAGTTATGAAGAACACTTCTCGAGAAGTGTTCTTCATAACTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_031280.2-185s1c1
Sequence:CCGGCCAAGTTTCCTTTCAACCAGTCTCGAGACTGGTTGAAAGGAAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-523s1c1
Sequence:CCGGGAGAAACATCGAAAGGACAAACTCGAGTTTGTCCTTTCGATGTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-387s1c1
Sequence:CCGGCAACAAGAAGGAGATGCTAAACTCGAGTTTAGCATCTCCTTCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031280.2-553s1c1
Sequence:CCGGCGCTATCTGCTAATGAGCATTCTCGAGAATGCTCATTAGCAGATAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_031280.2-331s1c1
Sequence:CCGGCCTGGAATTGAGAAGGTTGATCTCGAGATCAACCTTCTCAATTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)