EMAIL THIS PAGE TO A FRIEND

MRPS16

mitochondrial ribosomal protein S16

85 Gene Product Result for
Synonyms: COXPD2 MRP-S16 RPMS16
UniProtKB ID: Q9Y3D3, Q96Q60
Gene ID:
Human(51021) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S16P family. The encoded protein is one of the most highly conserved ribosomal proteins between mammalian and yeast mitochondria. Three pseudogenes (located at 8q21.3, 20q13.32, 22q12-q13.1) for this gene have been described. [provided by RefSeq, Jul 2008]
Mouse(66242) mitochondrial ribosomal protein S16
Rat(688912) mitochondrial ribosomal protein S16
Zebrafish(450009) mitochondrial ribosomal protein S16
cow(510899) mitochondrial ribosomal protein S16
domestic cat(101085405) mitochondrial ribosomal protein S16
dog(609906) mitochondrial ribosomal protein S16
chicken(769996) mitochondrial ribosomal protein S16
fruit fly(36570) mitochondrial ribosomal protein S16
domestic guinea pig(100718134) mitochondrial ribosomal protein S16
naked mole-rat(101705630) mitochondrial ribosomal protein S16
sheep(101118413) mitochondrial ribosomal protein S16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016065 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016065 Rosetta Predictions human pricing
NM_001109518 Rosetta Predictions rat pricing
NM_025440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084429 predicted 306
2 SASI_Hs01_00084430 predicted 504
3 SASI_Hs01_00084431 predicted 808
4 SASI_Hs01_00084432 predicted 829
5 SASI_Hs01_00084433 predicted 625
6 SASI_Hs02_00348800 predicted 418
7 SASI_Hs01_00084434 predicted 303
8 SASI_Hs01_00084435 predicted 825
9 SASI_Hs01_00084436 predicted 636
10 SASI_Hs02_00348801 predicted 672
11 SASI_Hs01_00084437 predicted 639
12 SASI_Hs01_00084438 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249189 predicted 233
2 SASI_Rn02_00249190 predicted 298
3 SASI_Rn02_00249191 predicted 256
4 SASI_Rn02_00249192 predicted 246
5 SASI_Rn02_00249193 predicted 240
6 SASI_Rn02_00249194 predicted 378
7 SASI_Rn02_00249195 predicted 279
8 SASI_Rn02_00249196 predicted 236
9 SASI_Rn02_00249197 predicted 225
10 SASI_Rn02_00249198 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183131 predicted 261
2 SASI_Mm01_00183132 predicted 264
3 SASI_Mm01_00183133 predicted 268
4 SASI_Mm01_00183134 predicted 206
5 SASI_Mm01_00183136 predicted 228
6 SASI_Mm01_00183137 predicted 211
7 SASI_Mm01_00183138 predicted 232
8 SASI_Mm01_00183139 predicted 265
9 SASI_Mm02_00328267 predicted 200
10 SASI_Mm01_00183140 predicted 271
11 SASI_Mm01_00183135 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016065
VALIDATED
MRPS16 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S16
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-1636s1c1
Sequence:CCGGCCTCCCAAAGTGCTAGGATTACTCGAGTAATCCTAGCACTTTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-455s1c1
Sequence:CCGGCACCTCTCTAAGCCTATGGAACTCGAGTTCCATAGGCTTAGAGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-508s1c1
Sequence:CCGGGCATCCTATGATGATCACAAACTCGAGTTTGTGATCATCATAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-381s1c1
Sequence:CCGGTGCCCAACAGTCATGGAGAAACTCGAGTTTCTCCATGACTGTTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-530s1c1
Sequence:CCGGGCTGAGAGACTGCGAAGGAAACTCGAGTTTCCTTCGCAGTCTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016065.3-530s21c1
Sequence:CCGGGCTGAGAGACTGCGAAGGAAACTCGAGTTTCCTTCGCAGTCTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016065.3-455s21c1
Sequence:CCGGCACCTCTCTAAGCCTATGGAACTCGAGTTCCATAGGCTTAGAGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016065.3-381s21c1
Sequence:CCGGTGCCCAACAGTCATGGAGAAACTCGAGTTTCTCCATGACTGTTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016065.3-508s21c1
Sequence:CCGGGCATCCTATGATGATCACAAACTCGAGTTTGTGATCATCATAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016065
VALIDATED
MRPS16 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S16
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-1636s1c1
Sequence:CCGGCCTCCCAAAGTGCTAGGATTACTCGAGTAATCCTAGCACTTTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-455s1c1
Sequence:CCGGCACCTCTCTAAGCCTATGGAACTCGAGTTCCATAGGCTTAGAGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-508s1c1
Sequence:CCGGGCATCCTATGATGATCACAAACTCGAGTTTGTGATCATCATAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-381s1c1
Sequence:CCGGTGCCCAACAGTCATGGAGAAACTCGAGTTTCTCCATGACTGTTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-530s1c1
Sequence:CCGGGCTGAGAGACTGCGAAGGAAACTCGAGTTTCCTTCGCAGTCTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016065.3-530s21c1
Sequence:CCGGGCTGAGAGACTGCGAAGGAAACTCGAGTTTCCTTCGCAGTCTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016065.3-455s21c1
Sequence:CCGGCACCTCTCTAAGCCTATGGAACTCGAGTTCCATAGGCTTAGAGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016065.3-381s21c1
Sequence:CCGGTGCCCAACAGTCATGGAGAAACTCGAGTTTCTCCATGACTGTTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016065.3-508s21c1
Sequence:CCGGGCATCCTATGATGATCACAAACTCGAGTTTGTGATCATCATAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016065
VALIDATED
MRPS16 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S16
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-1636s1c1
Sequence:CCGGCCTCCCAAAGTGCTAGGATTACTCGAGTAATCCTAGCACTTTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-455s1c1
Sequence:CCGGCACCTCTCTAAGCCTATGGAACTCGAGTTCCATAGGCTTAGAGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-508s1c1
Sequence:CCGGGCATCCTATGATGATCACAAACTCGAGTTTGTGATCATCATAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-381s1c1
Sequence:CCGGTGCCCAACAGTCATGGAGAAACTCGAGTTTCTCCATGACTGTTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016065.3-530s1c1
Sequence:CCGGGCTGAGAGACTGCGAAGGAAACTCGAGTTTCCTTCGCAGTCTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016065.3-530s21c1
Sequence:CCGGGCTGAGAGACTGCGAAGGAAACTCGAGTTTCCTTCGCAGTCTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016065.3-455s21c1
Sequence:CCGGCACCTCTCTAAGCCTATGGAACTCGAGTTCCATAGGCTTAGAGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016065.3-381s21c1
Sequence:CCGGTGCCCAACAGTCATGGAGAAACTCGAGTTTCTCCATGACTGTTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016065.3-508s21c1
Sequence:CCGGGCATCCTATGATGATCACAAACTCGAGTTTGTGATCATCATAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025440
VALIDATED
MRPS16 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S16
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-111s1c1
Sequence:CCGGCCTAACCATACGCCTTGCTTTCTCGAGAAAGCAAGGCGTATGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-415s1c1
Sequence:CCGGGTCCTCTTAGCGTCTCAGAAACTCGAGTTTCTGAGACGCTAAGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-356s1c1
Sequence:CCGGCCCTTCATCCAATGATGATCACTCGAGTGATCATCATTGGATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025440.1-219s1c1
Sequence:CCGGCTCCTATGATCCACTACCCAACTCGAGTTGGGTAGTGGATCATAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-309s1c1
Sequence:CCGGCCTCTCTAAGCCTATGGAGAACTCGAGTTCTCCATAGGCTTAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-414s21c1
Sequence:CCGGGTCCTCTTAGCGTCTCAGAAACTCGAGTTTCTGAGACGCTAAGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-232s21c1
Sequence:CCGGTACCCAACAGTCACGGAGAAACTCGAGTTTCTCCGTGACTGTTGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-110s21c1
Sequence:CCGGCCTAACCATACGCCTTGCTTTCTCGAGAAAGCAAGGCGTATGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-268s21c1
Sequence:CCGGACCTGGACCGTATCCGGCATTCTCGAGAATGCCGGATACGGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-355s21c1
Sequence:CCGGCCCTTCATCCAATGATGATCACTCGAGTGATCATCATTGGATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025440
VALIDATED
MRPS16 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S16
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-111s1c1
Sequence:CCGGCCTAACCATACGCCTTGCTTTCTCGAGAAAGCAAGGCGTATGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-415s1c1
Sequence:CCGGGTCCTCTTAGCGTCTCAGAAACTCGAGTTTCTGAGACGCTAAGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-356s1c1
Sequence:CCGGCCCTTCATCCAATGATGATCACTCGAGTGATCATCATTGGATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025440.1-219s1c1
Sequence:CCGGCTCCTATGATCCACTACCCAACTCGAGTTGGGTAGTGGATCATAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-309s1c1
Sequence:CCGGCCTCTCTAAGCCTATGGAGAACTCGAGTTCTCCATAGGCTTAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-414s21c1
Sequence:CCGGGTCCTCTTAGCGTCTCAGAAACTCGAGTTTCTGAGACGCTAAGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-232s21c1
Sequence:CCGGTACCCAACAGTCACGGAGAAACTCGAGTTTCTCCGTGACTGTTGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-110s21c1
Sequence:CCGGCCTAACCATACGCCTTGCTTTCTCGAGAAAGCAAGGCGTATGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-268s21c1
Sequence:CCGGACCTGGACCGTATCCGGCATTCTCGAGAATGCCGGATACGGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-355s21c1
Sequence:CCGGCCCTTCATCCAATGATGATCACTCGAGTGATCATCATTGGATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025440
VALIDATED
MRPS16 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S16
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-111s1c1
Sequence:CCGGCCTAACCATACGCCTTGCTTTCTCGAGAAAGCAAGGCGTATGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-415s1c1
Sequence:CCGGGTCCTCTTAGCGTCTCAGAAACTCGAGTTTCTGAGACGCTAAGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-356s1c1
Sequence:CCGGCCCTTCATCCAATGATGATCACTCGAGTGATCATCATTGGATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025440.1-219s1c1
Sequence:CCGGCTCCTATGATCCACTACCCAACTCGAGTTGGGTAGTGGATCATAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025440.1-309s1c1
Sequence:CCGGCCTCTCTAAGCCTATGGAGAACTCGAGTTCTCCATAGGCTTAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-414s21c1
Sequence:CCGGGTCCTCTTAGCGTCTCAGAAACTCGAGTTTCTGAGACGCTAAGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-232s21c1
Sequence:CCGGTACCCAACAGTCACGGAGAAACTCGAGTTTCTCCGTGACTGTTGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-110s21c1
Sequence:CCGGCCTAACCATACGCCTTGCTTTCTCGAGAAAGCAAGGCGTATGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-268s21c1
Sequence:CCGGACCTGGACCGTATCCGGCATTCTCGAGAATGCCGGATACGGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025440.2-355s21c1
Sequence:CCGGCCCTTCATCCAATGATGATCACTCGAGTGATCATCATTGGATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)